Mutagenetix > Incidental Mutations

Incidental Mutation 'R1288:Rapgef3'

150682

Institutional Source

Beutler Lab

Gene Symbol

Rapgef3

Ensembl Gene

ENSMUSG00000022469

Gene Name

Rap guanine nucleotide exchange factor (GEF) 3

Synonyms

2310016P22Rik, 9330170P05Rik, Epac1

MMRRC Submission

039354-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R1288 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97744770-97767972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 97759342 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 267 (S267I)

Ref Sequence

ENSEMBL: ENSMUSP00000118148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134371] [ENSMUST00000134885] [ENSMUST00000146620] [ENSMUST00000149419] [ENSMUST00000177352] [ENSMUST00000175894]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123397

Predicted Effect

probably benign
Transcript: ENSMUST00000126854
AA Change: S267I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: S267I

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	6e-45	BLAST
RasGEF	661	926	7.98e-95	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128775
AA Change: S267I

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: S267I

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	7e-45	BLAST
RasGEF	661	909	5.53e-80	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129223
AA Change: S267I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: S267I

Domain	Start	End	E-Value	Type
DEP	111	186	2.05e-25	SMART
low complexity region	197	208	N/A	INTRINSIC
low complexity region	230	241	N/A	INTRINSIC
cNMP	245	364	2.53e-12	SMART
RasGEFN	383	514	7.04e-10	SMART
Blast:RasGEF	547	644	6e-45	BLAST
RasGEF	661	918	2.11e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000134371

SMART Domains

Protein: ENSMUSP00000122746
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
Blast:cNMP	1	24	9e-8	BLAST
PDB:3CF6\|E	1	67	5e-12	PDB
Blast:RasGEFN	36	67	2e-15	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000134885

SMART Domains

Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
RasGEF	1	216	2.91e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146214

Predicted Effect

probably benign
Transcript: ENSMUST00000146620

SMART Domains

Protein: ENSMUSP00000116673
Gene: ENSMUSG00000022469

Domain	Start	End	E-Value	Type
DEP	69	144	2.05e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149373

Predicted Effect

probably benign
Transcript: ENSMUST00000149419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153464

Predicted Effect

probably benign
Transcript: ENSMUST00000177352
AA Change: S225I

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469
AA Change: S225I

Domain	Start	End	E-Value	Type
DEP	69	144	2.05e-25	SMART
low complexity region	155	166	N/A	INTRINSIC
low complexity region	188	199	N/A	INTRINSIC
cNMP	203	322	2.53e-12	SMART
RasGEFN	341	472	7.04e-10	SMART
Blast:RasGEF	505	602	3e-45	BLAST
RasGEF	619	884	7.98e-95	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175894

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	A	T	5: 129,129,007	D247V	probably damaging	Het
Ano5	A	T	7: 51,546,872	S184C	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Atxn3	C	T	12: 101,942,178		probably null	Het
BC005537	A	T	13: 24,804,900	E54V	probably damaging	Het
Ccdc150	A	T	1: 54,364,458	E881V	probably damaging	Het
Cep126	A	T	9: 8,112,181	N130K	probably benign	Het
Enoph1	A	G	5: 100,040,279	T21A	possibly damaging	Het
Fbxw28	A	G	9: 109,337,293	I165T	probably damaging	Het
Lrp12	A	T	15: 39,878,403	N305K	probably damaging	Het
Msl2	A	G	9: 101,102,109	T561A	probably benign	Het
Mup21	G	T	4: 62,150,697	A19E	probably benign	Het
Myh13	T	C	11: 67,353,718	I1027T	probably benign	Het
Nkg7	A	G	7: 43,437,662		probably null	Het
Nme8	A	G	13: 19,674,449	V73A	possibly damaging	Het
Olfr1135	G	A	2: 87,671,572	A265V	probably benign	Het
Olfr123	T	A	17: 37,795,693	L83Q	probably damaging	Het
Olfr138	A	G	17: 38,275,223	T151A	probably benign	Het
Olfr68	A	T	7: 103,778,042	L101Q	possibly damaging	Het
Olfr822	A	G	10: 130,075,285	N292D	probably damaging	Het
Trhde	T	A	10: 114,801,290	D4V	probably benign	Het
Vmn1r234	CTT	CTTT	17: 21,229,251		probably null	Het
Zfp40	T	A	17: 23,182,162	I36L	probably benign	Het

Other mutations in Rapgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01314:Rapgef3	APN	15	97748223	missense	probably damaging	1.00
IGL01339:Rapgef3	APN	15	97758059	missense	probably damaging	1.00
IGL01670:Rapgef3	APN	15	97749662	missense	probably benign	0.15
IGL01902:Rapgef3	APN	15	97750300	missense	probably benign	0.32
IGL02137:Rapgef3	APN	15	97750144	missense	probably benign	0.08
IGL02419:Rapgef3	APN	15	97750290	missense	probably benign	0.33
IGL02427:Rapgef3	APN	15	97747136	splice site	probably null
IGL02648:Rapgef3	APN	15	97758392	missense	probably damaging	1.00
IGL02834:Rapgef3	APN	15	97748265	missense	probably damaging	0.98
IGL03389:Rapgef3	APN	15	97749516	missense	probably damaging	1.00
IGL03055:Rapgef3	UTSW	15	97749489	splice site	probably benign
R0394:Rapgef3	UTSW	15	97757819	intron	probably benign
R0538:Rapgef3	UTSW	15	97757817	intron	probably benign
R0744:Rapgef3	UTSW	15	97761585	splice site	probably benign
R1512:Rapgef3	UTSW	15	97757501	missense	probably benign	0.24
R1676:Rapgef3	UTSW	15	97761182	missense	probably benign	0.35
R1745:Rapgef3	UTSW	15	97750178	missense	probably benign	0.22
R1928:Rapgef3	UTSW	15	97750033	missense	probably damaging	1.00
R2063:Rapgef3	UTSW	15	97766961	missense	probably damaging	1.00
R2067:Rapgef3	UTSW	15	97766961	missense	probably damaging	1.00
R2092:Rapgef3	UTSW	15	97760723	missense	probably damaging	1.00
R4358:Rapgef3	UTSW	15	97748648	missense	probably benign	0.05
R4624:Rapgef3	UTSW	15	97758929	missense	probably damaging	1.00
R4627:Rapgef3	UTSW	15	97758929	missense	probably damaging	1.00
R4727:Rapgef3	UTSW	15	97760600	missense	probably damaging	1.00
R4812:Rapgef3	UTSW	15	97753803	missense	probably benign	0.21
R4928:Rapgef3	UTSW	15	97757375	missense	probably damaging	1.00
R5161:Rapgef3	UTSW	15	97757725	missense	probably damaging	1.00
R5442:Rapgef3	UTSW	15	97758861	missense	probably damaging	0.99
R5652:Rapgef3	UTSW	15	97758437	missense	probably benign	0.00
R5837:Rapgef3	UTSW	15	97757342	splice site	probably benign
R6056:Rapgef3	UTSW	15	97758861	missense	probably damaging	0.99
R6167:Rapgef3	UTSW	15	97767411	unclassified	probably benign
R6694:Rapgef3	UTSW	15	97759984	missense	probably benign	0.03
R7039:Rapgef3	UTSW	15	97761568	missense	probably benign	0.01
R7154:Rapgef3	UTSW	15	97753877	missense	probably benign
R7380:Rapgef3	UTSW	15	97766791	missense	probably benign	0.00
R7655:Rapgef3	UTSW	15	97761209	missense	probably damaging	1.00
R7656:Rapgef3	UTSW	15	97761209	missense	probably damaging	1.00
R7754:Rapgef3	UTSW	15	97757746	missense	probably damaging	1.00
R7849:Rapgef3	UTSW	15	97758390	critical splice donor site	probably null
R8061:Rapgef3	UTSW	15	97761520	missense	probably benign
R8117:Rapgef3	UTSW	15	97750866	missense	probably benign	0.01
R8179:Rapgef3	UTSW	15	97760740	missense	probably benign	0.06
R8819:Rapgef3	UTSW	15	97748657	missense	probably benign	0.39
R8820:Rapgef3	UTSW	15	97748657	missense	probably benign	0.39
R8824:Rapgef3	UTSW	15	97766908	missense	probably benign	0.39
RF024:Rapgef3	UTSW	15	97760740	missense	probably benign	0.06
X0011:Rapgef3	UTSW	15	97761473	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCCACACGCAGAAAGTGACAG -3'
(R):5'- TGACCATAGCTCTATCCTCCAGTGC -3'

Sequencing Primer
(F):5'- GACAGTTGACATCTATCCCAGTGG -3'
(R):5'- AGTGCTGTCTTTGGATATACCC -3'

Posted On

2014-01-29