Incidental Mutation 'R1288:Vmn1r234'
ID150683
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1288 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTT to CTTT at 21229251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably null
Transcript: ENSMUST00000079633
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177028
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Cep126 A T 9: 8,112,181 N130K probably benign Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Fbxw28 A G 9: 109,337,293 I165T probably damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Msl2 A G 9: 101,102,109 T561A probably benign Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr123 T A 17: 37,795,693 L83Q probably damaging Het
Olfr138 A G 17: 38,275,223 T151A probably benign Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7482:Vmn1r234 UTSW 17 21229375 missense probably benign 0.07
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
R8295:Vmn1r234 UTSW 17 21228839 missense probably benign 0.01
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGTTCCACAAGCAATGGCAGC -3'
(R):5'- CTGTGCCTGTGCAAAATGAGAACC -3'

Sequencing Primer
(F):5'- CACAAGCAATGGCAGCTTTTG -3'
(R):5'- ACATTGCACAATTTTGCAGACA -3'
Posted On2014-01-29