Incidental Mutation 'R1288:Olfr123'
ID150685
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1288 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37795693 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 83 (L83Q)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478]
Predicted Effect probably damaging
Transcript: ENSMUST00000054748
AA Change: L83Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: L83Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect probably damaging
Transcript: ENSMUST00000214770
AA Change: L83Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably damaging
Transcript: ENSMUST00000216051
AA Change: L83Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Cep126 A T 9: 8,112,181 N130K probably benign Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Fbxw28 A G 9: 109,337,293 I165T probably damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Msl2 A G 9: 101,102,109 T561A probably benign Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr138 A G 17: 38,275,223 T151A probably benign Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3753:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3780:Olfr123 UTSW 17 37796004 missense probably damaging 1.00
R3947:Olfr123 UTSW 17 37796115 missense probably benign
R5925:Olfr123 UTSW 17 37795591 missense probably benign 0.00
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R7997:Olfr123 UTSW 17 37796162 nonsense probably null
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCAGCCTCAGTTGGAAAGGAGAC -3'
(R):5'- GCTTGATCATGGAGGGGACTTCAC -3'

Sequencing Primer
(F):5'- CAGTTGGAAAGGAGACTCTTCATTG -3'
(R):5'- ACTGAGCCATGAGATTCCTG -3'
Posted On2014-01-29