Incidental Mutation 'R1293:Olfm3'
ID150694
Institutional Source Beutler Lab
Gene Symbol Olfm3
Ensembl Gene ENSMUSG00000027965
Gene Nameolfactomedin 3
Synonymsoptimedin, B230206G02Rik
MMRRC Submission 039359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1293 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location114904078-115125722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115101930 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 154 (I154V)
Ref Sequence ENSEMBL: ENSMUSP00000121097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051309] [ENSMUST00000081752] [ENSMUST00000149158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051309
AA Change: I187V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060985
Gene: ENSMUSG00000027965
AA Change: I187V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 46 145 3.9e-52 PFAM
Blast:OLF 162 207 3e-8 BLAST
OLF 220 470 4.33e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081752
AA Change: I167V

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080448
Gene: ENSMUSG00000027965
AA Change: I167V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Noelin-1 25 125 7.6e-54 PFAM
Blast:OLF 142 187 3e-8 BLAST
OLF 200 450 4.33e-114 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149158
AA Change: I154V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121097
Gene: ENSMUSG00000027965
AA Change: I154V

DomainStartEndE-ValueType
Pfam:Noelin-1 12 112 2.5e-51 PFAM
Blast:OLF 129 174 1e-8 BLAST
Blast:OLF 187 210 1e-7 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,551,221 R289Q probably benign Het
Adgrl4 G A 3: 151,507,444 E374K probably benign Het
Ate1 G A 7: 130,394,725 R505C probably benign Het
Cntn4 T C 6: 106,353,724 I101T probably benign Het
Dmtf1 T A 5: 9,140,383 probably null Het
Dnah17 C A 11: 118,127,137 probably null Het
Efhc1 A G 1: 20,978,772 T470A probably damaging Het
Fam118b A T 9: 35,221,425 Y313N probably damaging Het
Gm10142 T C 10: 77,716,035 S77P probably benign Het
Kat8 T C 7: 127,922,250 probably null Het
Lrp2 T C 2: 69,523,302 probably null Het
Lrrc10 A G 10: 117,045,933 T171A probably benign Het
Mcidas A G 13: 112,997,392 T137A probably benign Het
Med1 G A 11: 98,157,036 T978I possibly damaging Het
Muc6 C A 7: 141,651,990 C75F probably damaging Het
Olfr1382 G A 11: 49,535,566 C127Y probably damaging Het
Olfr697 A G 7: 106,741,851 C28R probably damaging Het
Olfr849 A T 9: 19,441,432 E173V probably benign Het
Olfr992 T A 2: 85,400,353 probably null Het
Rsrc1 G A 3: 67,356,279 R324Q probably damaging Het
Samd9l G T 6: 3,373,947 P1105T possibly damaging Het
Sgcb C A 5: 73,635,527 V311F probably benign Het
Siglec1 A G 2: 131,073,531 V1380A probably benign Het
Spred1 C T 2: 117,177,408 P265L probably damaging Het
Unc13b T A 4: 43,235,190 H3259Q probably damaging Het
Unc13c C T 9: 73,574,074 D1694N probably benign Het
Usp24 A G 4: 106,423,553 R2355G probably benign Het
Vmn1r53 T A 6: 90,224,214 N43Y possibly damaging Het
Wtip T C 7: 34,110,221 S359G possibly damaging Het
Zfp984 T A 4: 147,755,941 K151M possibly damaging Het
Other mutations in Olfm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Olfm3 APN 3 115122633 missense probably damaging 1.00
IGL01686:Olfm3 APN 3 115122848 missense probably benign 0.00
IGL01732:Olfm3 APN 3 115097000 missense possibly damaging 0.82
IGL02539:Olfm3 APN 3 115101930 missense possibly damaging 0.93
IGL02580:Olfm3 APN 3 115122508 missense probably damaging 1.00
IGL02999:Olfm3 APN 3 115122748 missense probably damaging 1.00
IGL03142:Olfm3 APN 3 115097030 missense probably damaging 0.97
IGL03239:Olfm3 APN 3 115122594 missense probably damaging 0.99
R0361:Olfm3 UTSW 3 115120973 missense probably damaging 1.00
R0373:Olfm3 UTSW 3 115122805 missense probably damaging 0.99
R0505:Olfm3 UTSW 3 115122681 missense possibly damaging 0.46
R0689:Olfm3 UTSW 3 115122545 missense probably benign 0.28
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0973:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R0974:Olfm3 UTSW 3 115101986 missense probably benign 0.00
R1253:Olfm3 UTSW 3 115122769 missense probably damaging 0.98
R1952:Olfm3 UTSW 3 115101940 missense probably null 1.00
R2255:Olfm3 UTSW 3 115122193 splice site probably null
R2334:Olfm3 UTSW 3 115101959 nonsense probably null
R2510:Olfm3 UTSW 3 115122310 missense probably damaging 1.00
R4222:Olfm3 UTSW 3 115090171 nonsense probably null
R4716:Olfm3 UTSW 3 115081106 missense probably benign 0.00
R4912:Olfm3 UTSW 3 115101940 missense probably damaging 1.00
R5084:Olfm3 UTSW 3 114904553 critical splice donor site probably null
R5649:Olfm3 UTSW 3 115096924 missense probably damaging 0.99
R5681:Olfm3 UTSW 3 115122275 missense probably benign 0.28
R5861:Olfm3 UTSW 3 115122403 missense probably damaging 1.00
R5924:Olfm3 UTSW 3 115122538 missense probably benign 0.44
R5929:Olfm3 UTSW 3 115101880 missense probably damaging 0.97
R5958:Olfm3 UTSW 3 115122306 missense probably damaging 0.99
R6166:Olfm3 UTSW 3 115122425 missense probably damaging 1.00
R6299:Olfm3 UTSW 3 115120983 missense probably damaging 1.00
R6804:Olfm3 UTSW 3 115122679 missense probably benign 0.10
R7032:Olfm3 UTSW 3 115090156 missense probably damaging 1.00
R7565:Olfm3 UTSW 3 115122744 missense probably damaging 0.98
R7600:Olfm3 UTSW 3 115096940 missense possibly damaging 0.65
R7976:Olfm3 UTSW 3 115081145 missense probably benign 0.00
R8070:Olfm3 UTSW 3 115101955 missense probably damaging 0.96
R8334:Olfm3 UTSW 3 115122557 missense probably damaging 0.96
Z1088:Olfm3 UTSW 3 114904668 start gained probably benign
Z1177:Olfm3 UTSW 3 115081101 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGAAACACTCTATTGCTTTCTCCAGG -3'
(R):5'- CAAAAGTTCTCAGCCATGCTCACG -3'

Sequencing Primer
(F):5'- GCTTTCTCCAGGAGTTGAAAGAG -3'
(R):5'- AGAGACACTTGGCCCTGTAATTC -3'
Posted On2014-01-29