Incidental Mutation 'R1293:Sgcb'
ID150701
Institutional Source Beutler Lab
Gene Symbol Sgcb
Ensembl Gene ENSMUSG00000029156
Gene Namesarcoglycan, beta (dystrophin-associated glycoprotein)
Synonymsbeta-SG
MMRRC Submission 039359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1293 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73632749-73647790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73635527 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 311 (V311F)
Ref Sequence ENSEMBL: ENSMUSP00000079937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170] [ENSMUST00000087177]
Predicted Effect probably benign
Transcript: ENSMUST00000081170
AA Change: V311F

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156
AA Change: V311F

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087177
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit muscular dystrophy and cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,551,221 R289Q probably benign Het
Adgrl4 G A 3: 151,507,444 E374K probably benign Het
Ate1 G A 7: 130,394,725 R505C probably benign Het
Cntn4 T C 6: 106,353,724 I101T probably benign Het
Dmtf1 T A 5: 9,140,383 probably null Het
Dnah17 C A 11: 118,127,137 probably null Het
Efhc1 A G 1: 20,978,772 T470A probably damaging Het
Fam118b A T 9: 35,221,425 Y313N probably damaging Het
Gm10142 T C 10: 77,716,035 S77P probably benign Het
Kat8 T C 7: 127,922,250 probably null Het
Lrp2 T C 2: 69,523,302 probably null Het
Lrrc10 A G 10: 117,045,933 T171A probably benign Het
Mcidas A G 13: 112,997,392 T137A probably benign Het
Med1 G A 11: 98,157,036 T978I possibly damaging Het
Muc6 C A 7: 141,651,990 C75F probably damaging Het
Olfm3 A G 3: 115,101,930 I154V possibly damaging Het
Olfr1382 G A 11: 49,535,566 C127Y probably damaging Het
Olfr697 A G 7: 106,741,851 C28R probably damaging Het
Olfr849 A T 9: 19,441,432 E173V probably benign Het
Olfr992 T A 2: 85,400,353 probably null Het
Rsrc1 G A 3: 67,356,279 R324Q probably damaging Het
Samd9l G T 6: 3,373,947 P1105T possibly damaging Het
Siglec1 A G 2: 131,073,531 V1380A probably benign Het
Spred1 C T 2: 117,177,408 P265L probably damaging Het
Unc13b T A 4: 43,235,190 H3259Q probably damaging Het
Unc13c C T 9: 73,574,074 D1694N probably benign Het
Usp24 A G 4: 106,423,553 R2355G probably benign Het
Vmn1r53 T A 6: 90,224,214 N43Y possibly damaging Het
Wtip T C 7: 34,110,221 S359G possibly damaging Het
Zfp984 T A 4: 147,755,941 K151M possibly damaging Het
Other mutations in Sgcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sgcb APN 5 73635678 missense possibly damaging 0.92
IGL02504:Sgcb APN 5 73644375 missense probably damaging 0.96
IGL03330:Sgcb APN 5 73639869 missense probably damaging 1.00
PIT4445001:Sgcb UTSW 5 73639812 missense probably damaging 0.99
R0708:Sgcb UTSW 5 73640882 splice site probably null
R1016:Sgcb UTSW 5 73639840 missense probably benign 0.18
R1119:Sgcb UTSW 5 73644414 missense probably damaging 1.00
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R2762:Sgcb UTSW 5 73635709 splice site probably null
R5499:Sgcb UTSW 5 73644405 missense probably damaging 0.99
R6120:Sgcb UTSW 5 73640810 missense possibly damaging 0.62
R6809:Sgcb UTSW 5 73640693 missense probably benign 0.03
R7484:Sgcb UTSW 5 73639845 missense possibly damaging 0.86
R7647:Sgcb UTSW 5 73639377 splice site probably null
R8797:Sgcb UTSW 5 73635693 missense probably benign 0.00
R8939:Sgcb UTSW 5 73644318 missense probably damaging 0.98
Z1177:Sgcb UTSW 5 73644285 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATAGACACAGTGGTGCTCCCCAG -3'
(R):5'- ATGGCTTTACTCTCTGACTGCCAAC -3'

Sequencing Primer
(F):5'- TGCTCCCCAGGTAAAATAATTACAAG -3'
(R):5'- TGTGTTCCCATAGGAAAACAGC -3'
Posted On2014-01-29