Incidental Mutation 'R1293:Olfr697'
ID150706
Institutional Source Beutler Lab
Gene Symbol Olfr697
Ensembl Gene ENSMUSG00000051591
Gene Nameolfactory receptor 697
SynonymsGA_x6K02T2PBJ9-9119301-9118348, MOR283-5
MMRRC Submission 039359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1293 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106740834-106742443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106741851 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 28 (C28R)
Ref Sequence ENSEMBL: ENSMUSP00000152039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050541] [ENSMUST00000217734]
Predicted Effect probably damaging
Transcript: ENSMUST00000050541
AA Change: C28R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055207
Gene: ENSMUSG00000051591
AA Change: C28R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.7e-7 PFAM
Pfam:7tm_1 41 290 8.7e-26 PFAM
Pfam:7TM_GPCR_Srx 69 306 4.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217734
AA Change: C28R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,551,221 R289Q probably benign Het
Adgrl4 G A 3: 151,507,444 E374K probably benign Het
Ate1 G A 7: 130,394,725 R505C probably benign Het
Cntn4 T C 6: 106,353,724 I101T probably benign Het
Dmtf1 T A 5: 9,140,383 probably null Het
Dnah17 C A 11: 118,127,137 probably null Het
Efhc1 A G 1: 20,978,772 T470A probably damaging Het
Fam118b A T 9: 35,221,425 Y313N probably damaging Het
Gm10142 T C 10: 77,716,035 S77P probably benign Het
Kat8 T C 7: 127,922,250 probably null Het
Lrp2 T C 2: 69,523,302 probably null Het
Lrrc10 A G 10: 117,045,933 T171A probably benign Het
Mcidas A G 13: 112,997,392 T137A probably benign Het
Med1 G A 11: 98,157,036 T978I possibly damaging Het
Muc6 C A 7: 141,651,990 C75F probably damaging Het
Olfm3 A G 3: 115,101,930 I154V possibly damaging Het
Olfr1382 G A 11: 49,535,566 C127Y probably damaging Het
Olfr849 A T 9: 19,441,432 E173V probably benign Het
Olfr992 T A 2: 85,400,353 probably null Het
Rsrc1 G A 3: 67,356,279 R324Q probably damaging Het
Samd9l G T 6: 3,373,947 P1105T possibly damaging Het
Sgcb C A 5: 73,635,527 V311F probably benign Het
Siglec1 A G 2: 131,073,531 V1380A probably benign Het
Spred1 C T 2: 117,177,408 P265L probably damaging Het
Unc13b T A 4: 43,235,190 H3259Q probably damaging Het
Unc13c C T 9: 73,574,074 D1694N probably benign Het
Usp24 A G 4: 106,423,553 R2355G probably benign Het
Vmn1r53 T A 6: 90,224,214 N43Y possibly damaging Het
Wtip T C 7: 34,110,221 S359G possibly damaging Het
Zfp984 T A 4: 147,755,941 K151M possibly damaging Het
Other mutations in Olfr697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr697 APN 7 106741701 missense probably benign 0.20
IGL00937:Olfr697 APN 7 106741157 missense probably damaging 1.00
IGL01368:Olfr697 APN 7 106741622 missense probably benign 0.19
IGL01410:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01415:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01962:Olfr697 APN 7 106741784 missense probably benign 0.12
IGL02654:Olfr697 APN 7 106741348 nonsense probably null
IGL02903:Olfr697 APN 7 106741710 missense probably damaging 1.00
IGL03347:Olfr697 APN 7 106740970 utr 3 prime probably benign
IGL03391:Olfr697 APN 7 106741755 missense probably damaging 1.00
R0139:Olfr697 UTSW 7 106741625 missense probably benign 0.05
R0142:Olfr697 UTSW 7 106741765 missense probably benign 0.36
R1522:Olfr697 UTSW 7 106741005 missense probably benign 0.03
R1715:Olfr697 UTSW 7 106741548 missense probably damaging 1.00
R1959:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R1960:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R2031:Olfr697 UTSW 7 106741898 missense probably damaging 1.00
R4790:Olfr697 UTSW 7 106741791 missense probably benign 0.05
R5550:Olfr697 UTSW 7 106741133 missense probably benign 0.01
R6232:Olfr697 UTSW 7 106741554 missense probably damaging 0.96
R6293:Olfr697 UTSW 7 106741406 missense probably damaging 1.00
R6643:Olfr697 UTSW 7 106741704 missense probably benign 0.06
R7831:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R7914:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R8013:Olfr697 UTSW 7 106741617 missense probably benign 0.00
R8014:Olfr697 UTSW 7 106741617 missense probably benign 0.00
RF018:Olfr697 UTSW 7 106741485 missense probably benign 0.02
X0020:Olfr697 UTSW 7 106741136 missense probably damaging 0.97
Z1088:Olfr697 UTSW 7 106741143 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGACAGCTTTGGGAGTAATGACTGATG -3'
(R):5'- CACTCTCTTTAAGCAACCGAAGGGAAG -3'

Sequencing Primer
(F):5'- ATGTCAGGAGGAGATCAATGAG -3'
(R):5'- ATAGGGTAGAGCTGAGTATCATTTCC -3'
Posted On2014-01-29