Incidental Mutation 'R1293:Fam118b'
ID150711
Institutional Source Beutler Lab
Gene Symbol Fam118b
Ensembl Gene ENSMUSG00000050471
Gene Namefamily with sequence similarity 118, member B
Synonyms
MMRRC Submission 039359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1293 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35216965-35267805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35221425 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 313 (Y313N)
Ref Sequence ENSEMBL: ENSMUSP00000113537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000132799] [ENSMUST00000214230] [ENSMUST00000217306]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059057
AA Change: Y313N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471
AA Change: Y313N

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063782
AA Change: Y237N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471
AA Change: Y237N

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121564
AA Change: Y313N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471
AA Change: Y313N

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125087
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133739
SMART Domains Protein: ENSMUSP00000121690
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214230
Predicted Effect probably damaging
Transcript: ENSMUST00000217306
AA Change: Y38N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,551,221 R289Q probably benign Het
Adgrl4 G A 3: 151,507,444 E374K probably benign Het
Ate1 G A 7: 130,394,725 R505C probably benign Het
Cntn4 T C 6: 106,353,724 I101T probably benign Het
Dmtf1 T A 5: 9,140,383 probably null Het
Dnah17 C A 11: 118,127,137 probably null Het
Efhc1 A G 1: 20,978,772 T470A probably damaging Het
Gm10142 T C 10: 77,716,035 S77P probably benign Het
Kat8 T C 7: 127,922,250 probably null Het
Lrp2 T C 2: 69,523,302 probably null Het
Lrrc10 A G 10: 117,045,933 T171A probably benign Het
Mcidas A G 13: 112,997,392 T137A probably benign Het
Med1 G A 11: 98,157,036 T978I possibly damaging Het
Muc6 C A 7: 141,651,990 C75F probably damaging Het
Olfm3 A G 3: 115,101,930 I154V possibly damaging Het
Olfr1382 G A 11: 49,535,566 C127Y probably damaging Het
Olfr697 A G 7: 106,741,851 C28R probably damaging Het
Olfr849 A T 9: 19,441,432 E173V probably benign Het
Olfr992 T A 2: 85,400,353 probably null Het
Rsrc1 G A 3: 67,356,279 R324Q probably damaging Het
Samd9l G T 6: 3,373,947 P1105T possibly damaging Het
Sgcb C A 5: 73,635,527 V311F probably benign Het
Siglec1 A G 2: 131,073,531 V1380A probably benign Het
Spred1 C T 2: 117,177,408 P265L probably damaging Het
Unc13b T A 4: 43,235,190 H3259Q probably damaging Het
Unc13c C T 9: 73,574,074 D1694N probably benign Het
Usp24 A G 4: 106,423,553 R2355G probably benign Het
Vmn1r53 T A 6: 90,224,214 N43Y possibly damaging Het
Wtip T C 7: 34,110,221 S359G possibly damaging Het
Zfp984 T A 4: 147,755,941 K151M possibly damaging Het
Other mutations in Fam118b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1220:Fam118b UTSW 9 35223673 missense possibly damaging 0.82
R2079:Fam118b UTSW 9 35223664 missense possibly damaging 0.91
R4660:Fam118b UTSW 9 35235255 missense possibly damaging 0.86
R6418:Fam118b UTSW 9 35235337 missense probably damaging 1.00
R7000:Fam118b UTSW 9 35235264 missense probably damaging 1.00
R7016:Fam118b UTSW 9 35223718 missense probably damaging 1.00
R7095:Fam118b UTSW 9 35221490 missense possibly damaging 0.95
R7947:Fam118b UTSW 9 35217943 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTATGGCGGTCAAAGGACCAC -3'
(R):5'- ACTTTCCAGGCCCTGTTCCTAGAG -3'

Sequencing Primer
(F):5'- GGTCAAAGGACCACTTTAGGACTAC -3'
(R):5'- TGTTCCTAGAGGCCGTCAAG -3'
Posted On2014-01-29