Incidental Mutation 'R1289:Vmn1r234'
ID150746
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission 039355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1289 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTT to CTTT at 21229251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably null
Transcript: ENSMUST00000079633
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177028
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,890 Y367* probably null Het
9930021J03Rik T C 19: 29,723,452 I745M probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arap3 T C 18: 37,981,973 R997G possibly damaging Het
Col22a1 T G 15: 71,837,377 K655T unknown Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Glcci1 G A 6: 8,593,088 V298I possibly damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm9956 T A 10: 56,745,580 S113T probably damaging Het
Gpr75 T C 11: 30,892,706 I537T probably benign Het
Hars2 T G 18: 36,783,412 probably null Het
Helq A G 5: 100,796,464 V260A probably damaging Het
Ift172 A C 5: 31,280,976 F46V probably damaging Het
Klk1b9 A T 7: 43,978,424 I49L probably benign Het
Lrrk2 T G 15: 91,812,360 N2450K probably benign Het
Mtor T C 4: 148,470,307 V867A probably benign Het
Nlgn1 G T 3: 25,434,236 T645K possibly damaging Het
Nphs1 T C 7: 30,471,178 L931P probably damaging Het
Phf19 T C 2: 34,896,030 T476A probably benign Het
Rnf169 T C 7: 99,925,736 I551V probably benign Het
Ryr3 T A 2: 112,645,285 E4472V probably damaging Het
Tek T G 4: 94,804,830 F209V probably damaging Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7482:Vmn1r234 UTSW 17 21229375 missense probably benign 0.07
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
R8295:Vmn1r234 UTSW 17 21228839 missense probably benign 0.01
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGTTCCACAAGCAATGGCAGC -3'
(R):5'- CTGTGCCTGTGCAAAATGAGAACC -3'

Sequencing Primer
(F):5'- CACAAGCAATGGCAGCTTTTG -3'
(R):5'- ACATTGCACAATTTTGCAGACA -3'
Posted On2014-01-29