Incidental Mutation 'R1291:Vmn2r50'
ID150785
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Namevomeronasal 2, receptor 50
SynonymsEG434117
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1291 (G1)
Quality Score130
Status Not validated
Chromosome7
Chromosomal Location10037235-10053178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10037477 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 766 (T766A)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
Predicted Effect probably damaging
Transcript: ENSMUST00000074943
AA Change: T782A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: T782A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086298
AA Change: T766A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: T766A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 10037683 missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 10037437 missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 10047787 missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 10050325 missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 10037441 missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 10046002 missense probably damaging 0.99
PIT4651001:Vmn2r50 UTSW 7 10037732 missense probably benign 0.30
R0530:Vmn2r50 UTSW 7 10047717 missense possibly damaging 0.82
R1438:Vmn2r50 UTSW 7 10050135 nonsense probably null
R1713:Vmn2r50 UTSW 7 10037804 missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 10047678 missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 10052988 missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 10047683 missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 10053099 missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 10047713 missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 10037924 missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 10040382 missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 10052995 missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 10047907 missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4413:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 10037235 makesense probably null
R5151:Vmn2r50 UTSW 7 10053043 missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 10047825 missense probably damaging 1.00
R5457:Vmn2r50 UTSW 7 10047946 missense probably damaging 0.98
R5559:Vmn2r50 UTSW 7 10037326 missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 10050089 missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 10040372 missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 10047978 missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 10050059 missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 10040326 missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R6762:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R6995:Vmn2r50 UTSW 7 10046037 nonsense probably null
R6998:Vmn2r50 UTSW 7 10037757 missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 10050245 missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 10047612 missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 10050350 critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 10050139 missense probably null 0.00
R7704:Vmn2r50 UTSW 7 10047738 missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 10037371 missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 10037635 missense possibly damaging 0.70
R7996:Vmn2r50 UTSW 7 10047868 missense probably damaging 0.99
R8062:Vmn2r50 UTSW 7 10040313 critical splice donor site probably null
X0067:Vmn2r50 UTSW 7 10053027 missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 10037500 missense possibly damaging 0.91
Z1088:Vmn2r50 UTSW 7 10046159 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACATCACTAGAGCAACCAGTGAGAG -3'
(R):5'- TTCCTTGTATCAGGCACACCCAAC -3'

Sequencing Primer
(F):5'- TGAGAGTGATTCTAAAACTGGACAC -3'
(R):5'- TCAATGTGTTCTGTGTGCAATC -3'
Posted On2014-01-29