Incidental Mutation 'R1291:Psg20'
ID150786
Institutional Source Beutler Lab
Gene Symbol Psg20
Ensembl Gene ENSMUSG00000063305
Gene Namepregnancy-specific glycoprotein 20
Synonymscea7, EG434540
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18674107-18686185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18684674 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000104122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076677] [ENSMUST00000108482]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076677
AA Change: D56G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305
AA Change: D56G

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108482
AA Change: D56G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305
AA Change: D56G

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Psg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Psg20 APN 7 18674611 missense possibly damaging 0.72
IGL01459:Psg20 APN 7 18682713 missense probably damaging 1.00
IGL01599:Psg20 APN 7 18681038 missense possibly damaging 0.83
IGL01678:Psg20 APN 7 18680870 missense probably damaging 1.00
IGL01991:Psg20 APN 7 18684425 missense probably benign 0.01
IGL02449:Psg20 APN 7 18684408 splice site probably benign
IGL02522:Psg20 APN 7 18682431 missense probably benign 0.06
IGL03358:Psg20 APN 7 18680966 missense probably benign 0.04
PIT4431001:Psg20 UTSW 7 18674550 missense probably damaging 1.00
R0136:Psg20 UTSW 7 18682507 missense probably damaging 0.98
R0184:Psg20 UTSW 7 18685976 missense probably null 0.95
R0894:Psg20 UTSW 7 18681044 nonsense probably null
R1997:Psg20 UTSW 7 18682610 missense probably benign 0.00
R2118:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2119:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2120:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2121:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2124:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2127:Psg20 UTSW 7 18682718 missense probably damaging 0.99
R3795:Psg20 UTSW 7 18684449 missense probably benign 0.09
R4115:Psg20 UTSW 7 18685980 missense probably damaging 1.00
R4238:Psg20 UTSW 7 18684509 missense probably damaging 1.00
R5004:Psg20 UTSW 7 18680912 missense probably damaging 1.00
R5025:Psg20 UTSW 7 18674366 makesense probably null
R6294:Psg20 UTSW 7 18682679 missense probably damaging 1.00
R6733:Psg20 UTSW 7 18674622 missense probably damaging 0.99
R6744:Psg20 UTSW 7 18674580 missense probably damaging 1.00
R6799:Psg20 UTSW 7 18684420 missense probably benign 0.06
R7466:Psg20 UTSW 7 18684467 missense probably benign 0.00
R7524:Psg20 UTSW 7 18684659 missense probably benign 0.18
R7583:Psg20 UTSW 7 18682483 missense probably damaging 1.00
R8010:Psg20 UTSW 7 18681067 missense probably benign 0.06
R8247:Psg20 UTSW 7 18682637 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTATGTGCCTAGTGGAGGGACC -3'
(R):5'- TGCTCACACCTGCTCATGATTGTTG -3'

Sequencing Primer
(F):5'- GAAGAGTATAATATCCTGTGTCCTCC -3'
(R):5'- CTGCTCATGATTGTTGGCTTATTTC -3'
Posted On2014-01-29