Incidental Mutation 'R1291:Nell1'
ID150787
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene NameNEL-like 1
SynonymsB230343H07Rik, l7R6
MMRRC Submission 039357-MU
Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49974864-50866608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50230250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 330 (V330A)
Ref Sequence ENSEMBL: ENSMUSP00000103229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]
Predicted Effect probably benign
Transcript: ENSMUST00000081872
AA Change: V330A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: V330A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107603
AA Change: V330A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: V330A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145096
Predicted Effect probably benign
Transcript: ENSMUST00000151721
SMART Domains Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154410
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 50120673 missense probably damaging 0.96
IGL01434:Nell1 APN 7 50701208 missense probably benign 0.01
IGL01796:Nell1 APN 7 50176216 splice site probably benign
IGL02048:Nell1 APN 7 50219607 missense probably damaging 0.96
IGL02239:Nell1 APN 7 50249650 missense probably benign 0.08
IGL02860:Nell1 APN 7 50848485 missense probably damaging 0.99
IGL02958:Nell1 APN 7 50220337 critical splice donor site probably null
IGL03143:Nell1 APN 7 50279533 nonsense probably null
IGL03334:Nell1 APN 7 50062611 splice site probably null
D6062:Nell1 UTSW 7 50258191 missense probably benign 0.21
P0018:Nell1 UTSW 7 50120691 missense probably damaging 1.00
R0004:Nell1 UTSW 7 50560759 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0468:Nell1 UTSW 7 50228846 missense probably damaging 0.97
R0483:Nell1 UTSW 7 50230180 missense probably benign 0.07
R0732:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R0945:Nell1 UTSW 7 50219585 missense probably benign 0.07
R1022:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1024:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1075:Nell1 UTSW 7 50853840 missense probably damaging 0.98
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50848558 missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50701195 missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50560830 missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2263:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R2869:Nell1 UTSW 7 50249657 intron probably benign
R2870:Nell1 UTSW 7 50249657 intron probably benign
R2871:Nell1 UTSW 7 50249657 intron probably benign
R3498:Nell1 UTSW 7 50258179 missense possibly damaging 0.55
R4044:Nell1 UTSW 7 50219619 missense probably damaging 1.00
R4623:Nell1 UTSW 7 50120562 missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4733:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4941:Nell1 UTSW 7 50062638 missense probably benign 0.10
R4942:Nell1 UTSW 7 50120649 missense possibly damaging 0.84
R5233:Nell1 UTSW 7 50176314 missense probably damaging 0.99
R5590:Nell1 UTSW 7 50279611 missense probably damaging 1.00
R5673:Nell1 UTSW 7 50228846 missense probably damaging 0.99
R5741:Nell1 UTSW 7 50560890 unclassified probably null
R6345:Nell1 UTSW 7 49975423 missense possibly damaging 0.91
R6916:Nell1 UTSW 7 50701179 missense probably benign 0.00
R7051:Nell1 UTSW 7 50448844 missense unknown
R7302:Nell1 UTSW 7 50856269 missense probably benign
R7339:Nell1 UTSW 7 50279549 missense probably benign 0.01
R7831:Nell1 UTSW 7 49982800 missense possibly damaging 0.85
R7913:Nell1 UTSW 7 50279522 missense possibly damaging 0.93
R8094:Nell1 UTSW 7 50120587 missense probably benign 0.02
R8191:Nell1 UTSW 7 50448874 missense unknown
R8292:Nell1 UTSW 7 50258247 missense probably damaging 1.00
Z1176:Nell1 UTSW 7 50560882 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGTCCACATGGGCAGGTGGATG -3'
(R):5'- GGAGAAGCGACTTGGTCACTTCAG -3'

Sequencing Primer
(F):5'- AGGTCACATAGGTTCATTCCGAC -3'
(R):5'- CGACTTGGTCACTTCAGATGTAAAG -3'
Posted On2014-01-29