Mutagenetix > Incidental Mutation

Incidental Mutation 'R1291:Nell1'

150787

Institutional Source

Beutler Lab

Gene Symbol

Nell1

Ensembl Gene

ENSMUSG00000055409

Gene Name

NEL-like 1

Synonyms

l7R6, B230343H07Rik

MMRRC Submission

039357-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49625098-50513037 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49879998 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 330 (V330A)

Ref Sequence

ENSEMBL: ENSMUSP00000103229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]

AlphaFold

Q2VWQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000081872
AA Change: V330A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: V330A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_CA	549	595	1.08e-10	SMART
EGF_like	596	635	1.84e-4	SMART
VWC	634	686	1.42e0	SMART
VWC	694	749	1.83e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107603
AA Change: V330A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: V330A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_like	549	588	1.84e-4	SMART
VWC	587	639	1.42e0	SMART
VWC	647	702	1.83e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145096

Predicted Effect

probably benign
Transcript: ENSMUST00000151721

SMART Domains

Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154410

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	C	A	5: 30,404,532 (GRCm39)	L301F	probably damaging	Het
Apba1	G	T	19: 23,895,036 (GRCm39)	A491S	probably damaging	Het
Bmp5	A	T	9: 75,793,955 (GRCm39)	K355*	probably null	Het
Chdh	C	T	14: 29,753,519 (GRCm39)	R143*	probably null	Het
Evc2	A	G	5: 37,544,159 (GRCm39)	E636G	probably damaging	Het
Hmcn1	T	A	1: 150,623,942 (GRCm39)	I1120F	probably damaging	Het
Lama4	A	T	10: 38,924,065 (GRCm39)	H491L	probably benign	Het
Lrp1b	A	T	2: 41,231,907 (GRCm39)	S1074T	probably benign	Het
Psg20	T	C	7: 18,418,599 (GRCm39)	D56G	possibly damaging	Het
Ptk2	C	T	15: 73,082,605 (GRCm39)	V951I	probably damaging	Het
Qrfprl	T	A	6: 65,429,884 (GRCm39)	Y193*	probably null	Het
Rps23rg1	T	C	8: 3,633,938 (GRCm39)	I13T	probably damaging	Het
Rtel1	A	G	2: 180,992,836 (GRCm39)	D632G	probably damaging	Het
Smoc1	T	C	12: 81,226,365 (GRCm39)	F397L	probably damaging	Het
Spsb3	G	T	17: 25,106,782 (GRCm39)		probably null	Het
Srp68	A	T	11: 116,154,107 (GRCm39)	L154H	probably damaging	Het
Timp3	A	G	10: 86,181,702 (GRCm39)	Y191C	probably damaging	Het
Vmn2r50	T	C	7: 9,771,404 (GRCm39)	T766A	probably damaging	Het
Ythdc2	C	T	18: 44,988,276 (GRCm39)	S28F	probably benign	Het
Ywhaz	T	C	15: 36,772,978 (GRCm39)		probably benign	Het

Other mutations in Nell1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nell1	APN	7	49,770,421 (GRCm39)	missense	probably damaging	0.96
IGL01434:Nell1	APN	7	50,350,956 (GRCm39)	missense	probably benign	0.01
IGL01796:Nell1	APN	7	49,825,964 (GRCm39)	splice site	probably benign
IGL02048:Nell1	APN	7	49,869,355 (GRCm39)	missense	probably damaging	0.96
IGL02239:Nell1	APN	7	49,899,398 (GRCm39)	missense	probably benign	0.08
IGL02860:Nell1	APN	7	50,498,233 (GRCm39)	missense	probably damaging	0.99
IGL02958:Nell1	APN	7	49,870,085 (GRCm39)	critical splice donor site	probably null
IGL03143:Nell1	APN	7	49,929,281 (GRCm39)	nonsense	probably null
IGL03334:Nell1	APN	7	49,712,359 (GRCm39)	splice site	probably null
D6062:Nell1	UTSW	7	49,907,939 (GRCm39)	missense	probably benign	0.21
P0018:Nell1	UTSW	7	49,770,439 (GRCm39)	missense	probably damaging	1.00
R0004:Nell1	UTSW	7	50,210,507 (GRCm39)	splice site	probably benign
R0029:Nell1	UTSW	7	49,770,463 (GRCm39)	splice site	probably benign
R0029:Nell1	UTSW	7	49,770,463 (GRCm39)	splice site	probably benign
R0468:Nell1	UTSW	7	49,878,594 (GRCm39)	missense	probably damaging	0.97
R0483:Nell1	UTSW	7	49,879,928 (GRCm39)	missense	probably benign	0.07
R0732:Nell1	UTSW	7	50,506,135 (GRCm39)	missense	probably damaging	1.00
R0945:Nell1	UTSW	7	49,869,333 (GRCm39)	missense	probably benign	0.07
R1022:Nell1	UTSW	7	49,770,411 (GRCm39)	missense	probably damaging	1.00
R1024:Nell1	UTSW	7	49,770,411 (GRCm39)	missense	probably damaging	1.00
R1075:Nell1	UTSW	7	50,503,588 (GRCm39)	missense	probably damaging	0.98
R1404:Nell1	UTSW	7	50,503,621 (GRCm39)	missense	possibly damaging	0.91
R1404:Nell1	UTSW	7	50,503,621 (GRCm39)	missense	possibly damaging	0.91
R1634:Nell1	UTSW	7	50,498,306 (GRCm39)	missense	possibly damaging	0.82
R1928:Nell1	UTSW	7	50,350,943 (GRCm39)	missense	possibly damaging	0.51
R2060:Nell1	UTSW	7	50,210,578 (GRCm39)	missense	possibly damaging	0.58
R2261:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2262:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2263:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2448:Nell1	UTSW	7	50,506,135 (GRCm39)	missense	probably damaging	1.00
R2869:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R2870:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R2871:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R3498:Nell1	UTSW	7	49,907,927 (GRCm39)	missense	possibly damaging	0.55
R4044:Nell1	UTSW	7	49,869,367 (GRCm39)	missense	probably damaging	1.00
R4623:Nell1	UTSW	7	49,770,310 (GRCm39)	missense	possibly damaging	0.84
R4732:Nell1	UTSW	7	50,505,965 (GRCm39)	missense	probably damaging	1.00
R4733:Nell1	UTSW	7	50,505,965 (GRCm39)	missense	probably damaging	1.00
R4941:Nell1	UTSW	7	49,712,386 (GRCm39)	missense	probably benign	0.10
R4942:Nell1	UTSW	7	49,770,397 (GRCm39)	missense	possibly damaging	0.84
R5233:Nell1	UTSW	7	49,826,062 (GRCm39)	missense	probably damaging	0.99
R5590:Nell1	UTSW	7	49,929,359 (GRCm39)	missense	probably damaging	1.00
R5673:Nell1	UTSW	7	49,878,594 (GRCm39)	missense	probably damaging	0.99
R5741:Nell1	UTSW	7	50,210,638 (GRCm39)	splice site	probably null
R6345:Nell1	UTSW	7	49,625,171 (GRCm39)	missense	possibly damaging	0.91
R6916:Nell1	UTSW	7	50,350,927 (GRCm39)	missense	probably benign	0.00
R7051:Nell1	UTSW	7	50,098,592 (GRCm39)	missense	unknown
R7302:Nell1	UTSW	7	50,506,017 (GRCm39)	missense	probably benign
R7339:Nell1	UTSW	7	49,929,297 (GRCm39)	missense	probably benign	0.01
R7831:Nell1	UTSW	7	49,632,548 (GRCm39)	missense	possibly damaging	0.85
R7913:Nell1	UTSW	7	49,929,270 (GRCm39)	missense	possibly damaging	0.93
R8094:Nell1	UTSW	7	49,770,335 (GRCm39)	missense	probably benign	0.02
R8191:Nell1	UTSW	7	50,098,622 (GRCm39)	missense	unknown
R8207:Nell1	UTSW	7	49,869,760 (GRCm39)	splice site	probably null
R8292:Nell1	UTSW	7	49,907,995 (GRCm39)	missense	probably damaging	1.00
R8340:Nell1	UTSW	7	49,870,021 (GRCm39)	missense	probably damaging	0.98
R8673:Nell1	UTSW	7	49,869,343 (GRCm39)	missense	probably damaging	1.00
R8821:Nell1	UTSW	7	50,476,097 (GRCm39)	missense	probably damaging	0.98
R8987:Nell1	UTSW	7	50,498,399 (GRCm39)	missense	probably damaging	1.00
R8988:Nell1	UTSW	7	50,210,543 (GRCm39)	missense	unknown
R9095:Nell1	UTSW	7	50,506,150 (GRCm39)	missense	possibly damaging	0.92
R9300:Nell1	UTSW	7	49,712,368 (GRCm39)	missense	probably benign
R9370:Nell1	UTSW	7	49,770,292 (GRCm39)	missense	probably damaging	1.00
R9422:Nell1	UTSW	7	49,712,387 (GRCm39)	nonsense	probably null
R9428:Nell1	UTSW	7	50,503,683 (GRCm39)	missense	probably damaging	1.00
R9445:Nell1	UTSW	7	49,632,474 (GRCm39)	missense	possibly damaging	0.78
Z1176:Nell1	UTSW	7	50,210,630 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTAGTCCACATGGGCAGGTGGATG -3'
(R):5'- GGAGAAGCGACTTGGTCACTTCAG -3'

Sequencing Primer
(F):5'- AGGTCACATAGGTTCATTCCGAC -3'
(R):5'- CGACTTGGTCACTTCAGATGTAAAG -3'

Posted On

2014-01-29