Incidental Mutation 'R1291:C330021F23Rik'
ID150788
Institutional Source Beutler Lab
Gene Symbol C330021F23Rik
Ensembl Gene ENSMUSG00000065952
Gene NameRIKEN cDNA C330021F23 gene
SynonymsRps23rg1
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1291 (G1)
Quality Score119
Status Not validated
Chromosome8
Chromosomal Location3567990-3584939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3583938 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Ref Sequence ENSEMBL: ENSMUSP00000119487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000086479] [ENSMUST00000136592] [ENSMUST00000151633] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000057028
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086479
AA Change: I37T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136628
Gene: ENSMUSG00000065952
AA Change: I37T

DomainStartEndE-ValueType
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136592
AA Change: I37T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123235
Gene: ENSMUSG00000065952
AA Change: I37T

DomainStartEndE-ValueType
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146939
Predicted Effect probably damaging
Transcript: ENSMUST00000151633
AA Change: I13T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119487
Gene: ENSMUSG00000065952
AA Change: I13T

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171962
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
Predicted Effect probably benign
Transcript: ENSMUST00000207432
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect probably benign
Transcript: ENSMUST00000207970
Predicted Effect probably benign
Transcript: ENSMUST00000208036
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in C330021F23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:C330021F23Rik APN 8 3583904 missense probably benign 0.02
R4755:C330021F23Rik UTSW 8 3583922 missense probably damaging 1.00
R7796:C330021F23Rik UTSW 8 3584160 missense probably benign 0.00
R7835:C330021F23Rik UTSW 8 3580452 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGCTGCAACCCAAGTGCTG -3'
(R):5'- GTCACCGACGGGATCAGAAGTG -3'

Sequencing Primer
(F):5'- cacacacacacacacacacac -3'
(R):5'- CTGAAGGCCAATCCGTTTG -3'
Posted On2014-01-29