Incidental Mutation 'R1291:Bmp5'
ID 150789
Institutional Source Beutler Lab
Gene Symbol Bmp5
Ensembl Gene ENSMUSG00000032179
Gene Name bone morphogenetic protein 5
Synonyms
MMRRC Submission 039357-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R1291 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 75682646-75807592 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 75793955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 355 (K355*)
Ref Sequence ENSEMBL: ENSMUSP00000012281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012281]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000012281
AA Change: K355*
SMART Domains Protein: ENSMUSP00000012281
Gene: ENSMUSG00000032179
AA Change: K355*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TGFb_propeptide 31 304 5.2e-94 PFAM
low complexity region 316 331 N/A INTRINSIC
TGFB 353 454 3.54e-69 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Mice with null mutations in this gene exhibit a short ear phenotype, which is characterized by reduced size of the external ear, altered size and shape of the sternum, and other skeletal and soft-tissue abnormalities. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous recessive mutants have shortened, slightly ruffled external ears due to a defective cartilage framework affecting the whole skeleton; a series of genomic deletions of the region cause embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,404,532 (GRCm39) L301F probably damaging Het
Apba1 G T 19: 23,895,036 (GRCm39) A491S probably damaging Het
Chdh C T 14: 29,753,519 (GRCm39) R143* probably null Het
Evc2 A G 5: 37,544,159 (GRCm39) E636G probably damaging Het
Hmcn1 T A 1: 150,623,942 (GRCm39) I1120F probably damaging Het
Lama4 A T 10: 38,924,065 (GRCm39) H491L probably benign Het
Lrp1b A T 2: 41,231,907 (GRCm39) S1074T probably benign Het
Nell1 T C 7: 49,879,998 (GRCm39) V330A probably benign Het
Psg20 T C 7: 18,418,599 (GRCm39) D56G possibly damaging Het
Ptk2 C T 15: 73,082,605 (GRCm39) V951I probably damaging Het
Qrfprl T A 6: 65,429,884 (GRCm39) Y193* probably null Het
Rps23rg1 T C 8: 3,633,938 (GRCm39) I13T probably damaging Het
Rtel1 A G 2: 180,992,836 (GRCm39) D632G probably damaging Het
Smoc1 T C 12: 81,226,365 (GRCm39) F397L probably damaging Het
Spsb3 G T 17: 25,106,782 (GRCm39) probably null Het
Srp68 A T 11: 116,154,107 (GRCm39) L154H probably damaging Het
Timp3 A G 10: 86,181,702 (GRCm39) Y191C probably damaging Het
Vmn2r50 T C 7: 9,771,404 (GRCm39) T766A probably damaging Het
Ythdc2 C T 18: 44,988,276 (GRCm39) S28F probably benign Het
Ywhaz T C 15: 36,772,978 (GRCm39) probably benign Het
Other mutations in Bmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Bmp5 APN 9 75,746,895 (GRCm39) missense probably damaging 1.00
IGL02096:Bmp5 APN 9 75,805,833 (GRCm39) missense probably damaging 1.00
IGL02977:Bmp5 APN 9 75,801,081 (GRCm39) missense probably damaging 1.00
FR4976:Bmp5 UTSW 9 75,683,657 (GRCm39) small deletion probably benign
R1679:Bmp5 UTSW 9 75,746,877 (GRCm39) missense probably benign
R2049:Bmp5 UTSW 9 75,801,072 (GRCm39) missense probably damaging 1.00
R2278:Bmp5 UTSW 9 75,683,830 (GRCm39) missense possibly damaging 0.90
R5159:Bmp5 UTSW 9 75,801,035 (GRCm39) missense probably damaging 1.00
R5431:Bmp5 UTSW 9 75,800,991 (GRCm39) missense probably damaging 1.00
R5756:Bmp5 UTSW 9 75,683,649 (GRCm39) missense probably benign
R5884:Bmp5 UTSW 9 75,805,836 (GRCm39) missense probably damaging 1.00
R6749:Bmp5 UTSW 9 75,683,375 (GRCm39) start codon destroyed probably benign 0.00
R7346:Bmp5 UTSW 9 75,780,642 (GRCm39) missense probably damaging 1.00
R7522:Bmp5 UTSW 9 75,683,384 (GRCm39) missense probably benign
R7736:Bmp5 UTSW 9 75,801,072 (GRCm39) missense probably damaging 1.00
R8226:Bmp5 UTSW 9 75,683,606 (GRCm39) missense probably damaging 1.00
R8462:Bmp5 UTSW 9 75,746,874 (GRCm39) missense probably benign 0.03
R8955:Bmp5 UTSW 9 75,805,835 (GRCm39) missense probably damaging 1.00
R8968:Bmp5 UTSW 9 75,780,579 (GRCm39) missense probably benign 0.01
R9281:Bmp5 UTSW 9 75,683,856 (GRCm39) missense probably benign 0.35
R9766:Bmp5 UTSW 9 75,800,982 (GRCm39) missense probably damaging 0.99
RF053:Bmp5 UTSW 9 75,683,656 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGACAGCACCAGCC -3'
(R):5'- TCATCTGCAAATGCAAATGACTCATGC -3'

Sequencing Primer
(F):5'- CCAGCCTATGCCTGATGTATAAATG -3'
(R):5'- TCCCTAGATAGTTGTTAAACCCAACC -3'
Posted On 2014-01-29