Incidental Mutation 'R1291:Timp3'
ID150791
Institutional Source Beutler Lab
Gene Symbol Timp3
Ensembl Gene ENSMUSG00000020044
Gene Nametissue inhibitor of metalloproteinase 3
SynonymsTimp-3
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location86300372-86349506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86345838 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 191 (Y191C)
Ref Sequence ENSEMBL: ENSMUSP00000020234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020234] [ENSMUST00000120638] [ENSMUST00000121789] [ENSMUST00000132307]
Predicted Effect probably damaging
Transcript: ENSMUST00000020234
AA Change: Y191C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020234
Gene: ENSMUSG00000020044
AA Change: Y191C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
NTR 24 194 1.7e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120638
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121789
SMART Domains Protein: ENSMUSP00000113408
Gene: ENSMUSG00000059602

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 2.2e-25 PFAM
low complexity region 47 66 N/A INTRINSIC
Pfam:Synapsin 87 190 3.6e-63 PFAM
Pfam:Synapsin_C 192 242 6.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123783
Predicted Effect probably benign
Transcript: ENSMUST00000132307
SMART Domains Protein: ENSMUSP00000133236
Gene: ENSMUSG00000020044

DomainStartEndE-ValueType
Pfam:TIMP 3 50 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145864
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TIMP gene family. The proteins encoded by this gene family are inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix (ECM). Expression of this gene is induced in response to mitogenic stimulation and this netrin domain-containing protein is localized to the ECM. Mutations in this gene have been associated with the autosomal dominant disorder Sorsby's fundus dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null mice die prematurely with lethargy, ruffled hair, and a hunched posture, displaying impaired bronchiole branching, reduced alveologenesis and abnormal mammary gland involution. Knock-ins harboring a Ser156Cys missense mutation provide a mouse model for Sorsby fundus dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Timp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Timp3 APN 10 86338451 missense probably benign 0.06
IGL03057:Timp3 APN 10 86300951 missense possibly damaging 0.52
R1894:Timp3 UTSW 10 86345852 nonsense probably null
R2025:Timp3 UTSW 10 86300885 missense probably damaging 0.98
R6327:Timp3 UTSW 10 86345786 missense probably benign 0.00
R6742:Timp3 UTSW 10 86300878 missense probably benign 0.01
R6841:Timp3 UTSW 10 86345774 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACAGTATGTCTGGTGCCCAGTAG -3'
(R):5'- GACAGCAGAGACTTTAAGTGTCCCC -3'

Sequencing Primer
(F):5'- ACACTCAATGGGAGCTTATAGC -3'
(R):5'- AGACTTTAAGTGTCCCCAGTGC -3'
Posted On2014-01-29