Incidental Mutation 'R1291:Smoc1'
ID150793
Institutional Source Beutler Lab
Gene Symbol Smoc1
Ensembl Gene ENSMUSG00000021136
Gene NameSPARC related modular calcium binding 1
Synonyms2600002F22Rik, SPARC-related protein, SRG
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81026808-81186414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81179591 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 397 (F397L)
Ref Sequence ENSEMBL: ENSMUSP00000105976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021564] [ENSMUST00000110347] [ENSMUST00000129362]
Predicted Effect probably benign
Transcript: ENSMUST00000021564
AA Change: F386L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021564
Gene: ENSMUSG00000021136
AA Change: F386L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110347
AA Change: F397L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105976
Gene: ENSMUSG00000021136
AA Change: F397L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 258 306 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 323 434 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129362
AA Change: F386L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122858
Gene: ENSMUSG00000021136
AA Change: F386L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.5e-14 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a transposon-induced allele exhibit ocular and limb defects. Mice homozygous for a knock-out allele exhibit neonatal lethality, osseous syndactyly, decreased body size, and iris and retina coloboma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Smoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Smoc1 APN 12 81152751 nonsense probably null
R1902:Smoc1 UTSW 12 81104671 missense probably benign 0.32
R2109:Smoc1 UTSW 12 81150676 missense probably damaging 0.99
R2567:Smoc1 UTSW 12 81167590 missense probably damaging 0.99
R3900:Smoc1 UTSW 12 81167513 missense probably damaging 0.98
R4663:Smoc1 UTSW 12 81167602 missense probably damaging 1.00
R4762:Smoc1 UTSW 12 81167651 missense probably damaging 1.00
R4767:Smoc1 UTSW 12 81104773 critical splice donor site probably null
R4836:Smoc1 UTSW 12 81179548 missense probably damaging 1.00
R5264:Smoc1 UTSW 12 81104700 missense probably damaging 0.99
R5839:Smoc1 UTSW 12 81167585 missense probably damaging 1.00
R5898:Smoc1 UTSW 12 81104757 nonsense probably null
R7359:Smoc1 UTSW 12 81150701 missense probably damaging 1.00
V8831:Smoc1 UTSW 12 81168255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGCAAATGCTTAACCGTATCG -3'
(R):5'- AGGCATACAGGGGATAGAACTCACC -3'

Sequencing Primer
(F):5'- TAACCGTATCGAGTACCCTGG -3'
(R):5'- AGGGGATAGAACTCACCTTCTTTG -3'
Posted On2014-01-29