Incidental Mutation 'R1291:Ywhaz'
ID150796
Institutional Source Beutler Lab
Gene Symbol Ywhaz
Ensembl Gene ENSMUSG00000022285
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Synonyms1110013I11Rik, 14-3-3 zeta
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36770770-36796929 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 36772734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022894] [ENSMUST00000110361] [ENSMUST00000110362] [ENSMUST00000226851]
Predicted Effect unknown
Transcript: ENSMUST00000022894
AA Change: E241G
SMART Domains Protein: ENSMUSP00000022894
Gene: ENSMUSG00000022285
AA Change: E241G

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect unknown
Transcript: ENSMUST00000110361
AA Change: E241G
SMART Domains Protein: ENSMUSP00000105990
Gene: ENSMUSG00000022285
AA Change: E241G

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect unknown
Transcript: ENSMUST00000110362
AA Change: E241G
SMART Domains Protein: ENSMUSP00000105991
Gene: ENSMUSG00000022285
AA Change: E241G

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154879
Predicted Effect probably benign
Transcript: ENSMUST00000226851
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation after P14, some postnatal lethality by P21. Mice homozygous for one gene trap allele also exhibit neurodevelopmental and neuropsychiatric behaviour defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Other mutations in Ywhaz
AlleleSourceChrCoordTypePredicted EffectPPH Score
Impecunious UTSW 15 36790922 missense probably damaging 1.00
R0559:Ywhaz UTSW 15 36790964 missense possibly damaging 0.80
R1705:Ywhaz UTSW 15 36790715 missense possibly damaging 0.55
R5810:Ywhaz UTSW 15 36775266 missense probably damaging 1.00
R6579:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6582:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6583:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6642:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6643:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
X0027:Ywhaz UTSW 15 36775556 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCCCTTCTGAAGCCACAATGTACC -3'
(R):5'- TCCAACTAAAGCGTAGTCACATGCC -3'

Sequencing Primer
(F):5'- GTAAAAATTCCACATCCCATATTGGC -3'
(R):5'- CGTAGTCACATGCCAGACG -3'
Posted On2014-01-29