Mutagenetix > Incidental Mutation

Incidental Mutation 'R1291:Ptk2'

150797

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FAK, FRNK, Fadk

MMRRC Submission

039357-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73076951-73295129 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 73082605 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 951 (V951I)

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

AlphaFold

P34152

Predicted Effect

probably damaging
Transcript: ENSMUST00000110036
AA Change: V951I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: V951I

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226742

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226988
AA Change: V954I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228628

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	C	A	5: 30,404,532 (GRCm39)	L301F	probably damaging	Het
Apba1	G	T	19: 23,895,036 (GRCm39)	A491S	probably damaging	Het
Bmp5	A	T	9: 75,793,955 (GRCm39)	K355*	probably null	Het
Chdh	C	T	14: 29,753,519 (GRCm39)	R143*	probably null	Het
Evc2	A	G	5: 37,544,159 (GRCm39)	E636G	probably damaging	Het
Hmcn1	T	A	1: 150,623,942 (GRCm39)	I1120F	probably damaging	Het
Lama4	A	T	10: 38,924,065 (GRCm39)	H491L	probably benign	Het
Lrp1b	A	T	2: 41,231,907 (GRCm39)	S1074T	probably benign	Het
Nell1	T	C	7: 49,879,998 (GRCm39)	V330A	probably benign	Het
Psg20	T	C	7: 18,418,599 (GRCm39)	D56G	possibly damaging	Het
Qrfprl	T	A	6: 65,429,884 (GRCm39)	Y193*	probably null	Het
Rps23rg1	T	C	8: 3,633,938 (GRCm39)	I13T	probably damaging	Het
Rtel1	A	G	2: 180,992,836 (GRCm39)	D632G	probably damaging	Het
Smoc1	T	C	12: 81,226,365 (GRCm39)	F397L	probably damaging	Het
Spsb3	G	T	17: 25,106,782 (GRCm39)		probably null	Het
Srp68	A	T	11: 116,154,107 (GRCm39)	L154H	probably damaging	Het
Timp3	A	G	10: 86,181,702 (GRCm39)	Y191C	probably damaging	Het
Vmn2r50	T	C	7: 9,771,404 (GRCm39)	T766A	probably damaging	Het
Ythdc2	C	T	18: 44,988,276 (GRCm39)	S28F	probably benign	Het
Ywhaz	T	C	15: 36,772,978 (GRCm39)		probably benign	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73,134,396 (GRCm39)	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73,167,238 (GRCm39)	splice site	probably benign
IGL01605:Ptk2	APN	15	73,136,188 (GRCm39)	splice site	probably benign
IGL01631:Ptk2	APN	15	73,088,220 (GRCm39)	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73,101,780 (GRCm39)	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73,114,322 (GRCm39)	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73,192,675 (GRCm39)	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73,170,036 (GRCm39)	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73,077,994 (GRCm39)	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73,108,065 (GRCm39)	missense	probably damaging	1.00
Shooter	UTSW	15	73,176,293 (GRCm39)	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73,215,132 (GRCm39)	splice site	probably null
R0239:Ptk2	UTSW	15	73,215,132 (GRCm39)	splice site	probably null
R1254:Ptk2	UTSW	15	73,101,819 (GRCm39)	missense	probably benign	0.01
R1307:Ptk2	UTSW	15	73,163,895 (GRCm39)	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73,134,424 (GRCm39)	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73,134,459 (GRCm39)	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73,082,733 (GRCm39)	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73,087,832 (GRCm39)	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73,108,040 (GRCm39)	nonsense	probably null
R2114:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73,114,255 (GRCm39)	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73,137,965 (GRCm39)	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73,103,768 (GRCm39)	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73,181,698 (GRCm39)	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73,103,825 (GRCm39)	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73,078,045 (GRCm39)	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73,078,074 (GRCm39)	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73,087,945 (GRCm39)	splice site	probably null
R4847:Ptk2	UTSW	15	73,103,805 (GRCm39)	missense	probably benign
R5558:Ptk2	UTSW	15	73,176,294 (GRCm39)	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73,134,413 (GRCm39)	nonsense	probably null
R5858:Ptk2	UTSW	15	73,192,944 (GRCm39)	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73,175,682 (GRCm39)	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73,176,293 (GRCm39)	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73,101,762 (GRCm39)	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73,148,714 (GRCm39)	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73,093,658 (GRCm39)	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73,167,224 (GRCm39)	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73,170,048 (GRCm39)	frame shift	probably null
R8235:Ptk2	UTSW	15	73,215,140 (GRCm39)	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73,131,457 (GRCm39)	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73,087,933 (GRCm39)	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73,146,346 (GRCm39)	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73,215,041 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TCTAACGCTTCAAGGAAGCAGCC -3'
(R):5'- CGTCCTCAAACTGAACCATGCCTG -3'

Sequencing Primer
(F):5'- CAAGGAAGCAGCCTAGTACTTATTG -3'
(R):5'- AATTGTGGTGATACCTCACGC -3'

Posted On

2014-01-29