Incidental Mutation 'R1292:Ly9'
ID150802
Institutional Source Beutler Lab
Gene Symbol Ly9
Ensembl Gene ENSMUSG00000004707
Gene Namelymphocyte antigen 9
SynonymsT100, CD229, Lgp100, SLAMF3
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171588624-171607410 bp(-) (GRCm38)
Type of Mutationunclassified (2433 bp from exon)
DNA Base Change (assembly) T to C at 171589103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004827] [ENSMUST00000004829] [ENSMUST00000068878] [ENSMUST00000111277] [ENSMUST00000143463] [ENSMUST00000194797]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004827
AA Change: D531G

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004827
Gene: ENSMUSG00000004707
AA Change: D531G

DomainStartEndE-ValueType
Pfam:Ig_3 46 116 7.9e-9 PFAM
Pfam:Ig_2 46 129 5.4e-10 PFAM
IG 143 246 1.49e-2 SMART
Pfam:Ig_3 251 320 4.1e-13 PFAM
Pfam:Ig_2 251 330 7.5e-6 PFAM
transmembrane domain 345 364 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004829
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068878
AA Change: D641G

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069319
Gene: ENSMUSG00000004707
AA Change: D641G

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 5.6e-8 PFAM
Pfam:Ig_2 156 239 4e-8 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5.4e-10 PFAM
low complexity region 433 441 N/A INTRINSIC
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111277
SMART Domains Protein: ENSMUSP00000106908
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
IG 52 151 8.72e-4 SMART
Pfam:Ig_3 156 226 9.9e-9 PFAM
Pfam:Ig_2 156 239 6.8e-10 PFAM
IG 253 356 1.49e-2 SMART
Pfam:Ig_3 361 430 5e-13 PFAM
Pfam:Ig_2 361 440 9.4e-6 PFAM
transmembrane domain 455 474 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143463
SMART Domains Protein: ENSMUSP00000137924
Gene: ENSMUSG00000004707

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194797
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195804
Meta Mutation Damage Score 0.1458 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]).[supplied by OMIM, Mar 2008]
PHENOTYPE: This locus controls an antigen on thymocytes, lymphocytes and bone marrow cells. The a allele determines Ly9.1 antigen in A/J, 129/Re, BALB/c and C3H/He; the b allele determines antigen Ly9.2 in the C57 family of strains, HTI/Go, MA/My, F/St and C58/Lw. Null mutants are viable, healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Ly9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ly9 APN 1 171593451 missense probably damaging 1.00
IGL00640:Ly9 APN 1 171601879 missense possibly damaging 0.65
IGL01899:Ly9 APN 1 171607247 missense probably damaging 0.99
IGL02714:Ly9 APN 1 171605118 missense possibly damaging 0.60
IGL03086:Ly9 APN 1 171605170 missense probably benign 0.01
R0647:Ly9 UTSW 1 171599808 missense probably damaging 1.00
R1422:Ly9 UTSW 1 171601212 missense probably damaging 1.00
R1598:Ly9 UTSW 1 171596507 missense probably benign 0.03
R1985:Ly9 UTSW 1 171599773 missense probably damaging 1.00
R2219:Ly9 UTSW 1 171597681 splice site probably null
R2427:Ly9 UTSW 1 171607232 missense probably damaging 0.99
R3764:Ly9 UTSW 1 171594144 missense possibly damaging 0.92
R3815:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3816:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3817:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R3819:Ly9 UTSW 1 171589085 missense possibly damaging 0.95
R4590:Ly9 UTSW 1 171593875 nonsense probably null
R4653:Ly9 UTSW 1 171594029 missense probably benign 0.41
R4755:Ly9 UTSW 1 171607238 missense probably damaging 0.99
R4871:Ly9 UTSW 1 171607330 intron probably benign
R5167:Ly9 UTSW 1 171605205 missense probably damaging 1.00
R5203:Ly9 UTSW 1 171599779 missense probably damaging 1.00
R5270:Ly9 UTSW 1 171601162 missense probably damaging 0.99
R5692:Ly9 UTSW 1 171605187 frame shift probably null
R5996:Ly9 UTSW 1 171601828 missense probably damaging 1.00
R6389:Ly9 UTSW 1 171596537 missense probably damaging 1.00
R6391:Ly9 UTSW 1 171601008 missense possibly damaging 0.76
R6457:Ly9 UTSW 1 171589095 missense probably damaging 1.00
R6730:Ly9 UTSW 1 171605169 missense probably benign 0.14
R6732:Ly9 UTSW 1 171594085 missense possibly damaging 0.74
R6862:Ly9 UTSW 1 171601155 missense probably benign 0.21
R6866:Ly9 UTSW 1 171605279 missense probably damaging 0.99
R7455:Ly9 UTSW 1 171593939 nonsense probably null
R8105:Ly9 UTSW 1 171605322 splice site probably null
R8349:Ly9 UTSW 1 171594018 missense probably damaging 0.99
X0062:Ly9 UTSW 1 171605221 missense possibly damaging 0.82
Z1176:Ly9 UTSW 1 171594060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTCTGCCTGACCTGTGAATG -3'
(R):5'- TGGTCCTTAGCACTGGGACTCTTTC -3'

Sequencing Primer
(F):5'- CAAGAAGAGGAAGGCATCAAATTC -3'
(R):5'- TAGCACTGGGACTCTTTCCATAAAC -3'
Posted On2014-01-29