Incidental Mutation 'R1292:Olfr231'
ID150803
Institutional Source Beutler Lab
Gene Symbol Olfr231
Ensembl Gene ENSMUSG00000046486
Gene Nameolfactory receptor 231
SynonymsOlfr244, GA_x6K02T2LER7-6-623, Olfr425, GA_x6K02T2P20D-21053942-21054499, GA_x6K02T02K39-452-3, MOR105-4
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174113211-174121162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174117854 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 54 (F54S)
Ref Sequence ENSEMBL: ENSMUSP00000151011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063030] [ENSMUST00000214446]
Predicted Effect probably benign
Transcript: ENSMUST00000063030
AA Change: F54S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059596
Gene: ENSMUSG00000046486
AA Change: F54S

DomainStartEndE-ValueType
Pfam:7tm_4 24 300 2.6e-63 PFAM
Pfam:7tm_1 34 282 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214446
AA Change: F54S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Olfr231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr231 APN 1 174117533 missense probably damaging 1.00
IGL03126:Olfr231 APN 1 174117710 missense probably benign 0.07
R0200:Olfr231 UTSW 1 174117512 missense probably benign 0.00
R1966:Olfr231 UTSW 1 174117251 nonsense probably null
R2860:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2861:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2862:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R4492:Olfr231 UTSW 1 174117204 missense probably benign 0.01
R4594:Olfr231 UTSW 1 174117320 missense probably damaging 0.96
R4670:Olfr231 UTSW 1 174117861 missense probably benign 0.04
R4703:Olfr231 UTSW 1 174117398 missense possibly damaging 0.52
R6385:Olfr231 UTSW 1 174117296 missense probably damaging 1.00
R7085:Olfr231 UTSW 1 174117660 missense probably damaging 1.00
R7426:Olfr231 UTSW 1 174117187 missense probably benign 0.00
R7708:Olfr231 UTSW 1 174117734 missense probably damaging 0.99
R7780:Olfr231 UTSW 1 174117549 missense probably benign 0.02
Z1088:Olfr231 UTSW 1 174117315 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACAGCCTTCTGTGATACCCAACG -3'
(R):5'- AGTCCAGGAAATTCCAGGAAGTCCC -3'

Sequencing Primer
(F):5'- CTGTGATACCCAACGAGTGAAAAAAG -3'
(R):5'- GGAAATTCCAGGAAGTCCCTTATG -3'
Posted On2014-01-29