Incidental Mutation 'R1292:Srsf6'
ID150805
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Nameserine/arginine-rich splicing factor 6
SynonymsSfrs6, 1210001E11Rik
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location162931528-162937121 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 162934483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
Predicted Effect probably benign
Transcript: ENSMUST00000017065
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126163
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130411
AA Change: S249L
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: S249L

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.1601 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162931707 missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162933754 missense probably damaging 1.00
R1789:Srsf6 UTSW 2 162934488 unclassified probably benign
R1936:Srsf6 UTSW 2 162934483 unclassified probably benign
R1937:Srsf6 UTSW 2 162934483 unclassified probably benign
R1939:Srsf6 UTSW 2 162934483 unclassified probably benign
R1940:Srsf6 UTSW 2 162934483 unclassified probably benign
R2225:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162934291 unclassified probably benign
R4290:Srsf6 UTSW 2 162934716 unclassified probably benign
R4292:Srsf6 UTSW 2 162934716 unclassified probably benign
R4293:Srsf6 UTSW 2 162934716 unclassified probably benign
R4294:Srsf6 UTSW 2 162934716 unclassified probably benign
R4295:Srsf6 UTSW 2 162934716 unclassified probably benign
R4592:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162933709 missense probably benign 0.45
R4657:Srsf6 UTSW 2 162933427 missense probably benign 0.01
R7378:Srsf6 UTSW 2 162934569 missense unknown
R7446:Srsf6 UTSW 2 162934716 missense unknown
R7578:Srsf6 UTSW 2 162932862 missense probably benign 0.00
R7730:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R7908:Srsf6 UTSW 2 162933840 missense unknown
X0020:Srsf6 UTSW 2 162933498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCGCTCCCGGTAAATAATGTGG -3'
(R):5'- TGGAACTTGATCTGGACCTTGAACG -3'

Sequencing Primer
(F):5'- CCGGTAAATAATGTGGTATTGGGTC -3'
(R):5'- CTAGAACGGGACCTTGAAGCTC -3'
Posted On2014-01-29