Incidental Mutation 'R1292:Srsf6'
ID 150805
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Name serine and arginine-rich splicing factor 6
Synonyms 1210001E11Rik, Sfrs6
MMRRC Submission 039358-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.778) question?
Stock # R1292 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 162773448-162779041 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 162776403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
AlphaFold Q3TWW8
Predicted Effect probably benign
Transcript: ENSMUST00000017065
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126163
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000130411
AA Change: S249L
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: S249L

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.1601 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,336,919 (GRCm39) D74E probably benign Het
Abcb1a A T 5: 8,763,343 (GRCm39) T624S probably benign Het
Atp8b1 T C 18: 64,704,092 (GRCm39) Y342C probably damaging Het
Clcnka A G 4: 141,122,903 (GRCm39) probably benign Het
Cma2 C T 14: 56,211,199 (GRCm39) R164C probably damaging Het
Cnga1 T C 5: 72,762,026 (GRCm39) D496G probably damaging Het
Ctbp2 T A 7: 132,616,918 (GRCm39) R6W probably damaging Het
Cyp3a11 T C 5: 145,802,804 (GRCm39) T230A probably benign Het
Defb40 A C 8: 19,028,080 (GRCm39) I18S probably benign Het
Fcgbpl1 A C 7: 27,842,219 (GRCm39) probably benign Het
Gm10036 T G 18: 15,966,368 (GRCm39) I173S possibly damaging Het
Herc2 A T 7: 55,846,951 (GRCm39) I3634L probably benign Het
Igfbp1 A G 11: 7,150,863 (GRCm39) N218S probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Kmt2a A T 9: 44,725,991 (GRCm39) probably benign Het
Ly9 T C 1: 171,416,671 (GRCm39) probably null Het
Mmut C A 17: 41,252,298 (GRCm39) A280E probably damaging Het
Or5k16 C T 16: 58,736,134 (GRCm39) R290K probably damaging Het
Or6k6 A G 1: 173,945,420 (GRCm39) F54S probably benign Het
Pcdhb13 T C 18: 37,576,885 (GRCm39) V421A probably benign Het
Pik3ca T A 3: 32,508,569 (GRCm39) L779Q probably damaging Het
Plxnd1 T C 6: 115,939,644 (GRCm39) probably benign Het
Prss16 T A 13: 22,193,691 (GRCm39) K35* probably null Het
Rhbdl2 G A 4: 123,723,435 (GRCm39) A280T possibly damaging Het
Slc2a2 C T 3: 28,771,637 (GRCm39) T189I probably damaging Het
Tacr1 A G 6: 82,531,856 (GRCm39) I251V probably damaging Het
Tln1 A G 4: 43,534,578 (GRCm39) probably null Het
Vdac3-ps1 T C 13: 18,205,880 (GRCm39) noncoding transcript Het
Zfp458 A T 13: 67,404,754 (GRCm39) C562S probably damaging Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162,773,627 (GRCm39) missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162,775,674 (GRCm39) missense probably damaging 1.00
R1789:Srsf6 UTSW 2 162,776,408 (GRCm39) unclassified probably benign
R1936:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1937:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1939:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R1940:Srsf6 UTSW 2 162,776,403 (GRCm39) unclassified probably benign
R2225:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162,773,619 (GRCm39) missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162,776,211 (GRCm39) unclassified probably benign
R4290:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4292:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4293:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4294:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4295:Srsf6 UTSW 2 162,776,636 (GRCm39) unclassified probably benign
R4592:Srsf6 UTSW 2 162,773,643 (GRCm39) missense probably damaging 0.99
R4613:Srsf6 UTSW 2 162,775,629 (GRCm39) missense probably benign 0.45
R4657:Srsf6 UTSW 2 162,775,347 (GRCm39) missense probably benign 0.01
R7378:Srsf6 UTSW 2 162,776,489 (GRCm39) missense unknown
R7446:Srsf6 UTSW 2 162,776,636 (GRCm39) missense unknown
R7578:Srsf6 UTSW 2 162,774,782 (GRCm39) missense probably benign 0.00
R7730:Srsf6 UTSW 2 162,773,643 (GRCm39) missense probably damaging 0.99
R7908:Srsf6 UTSW 2 162,775,760 (GRCm39) missense unknown
R9498:Srsf6 UTSW 2 162,774,009 (GRCm39) missense probably benign 0.07
X0020:Srsf6 UTSW 2 162,775,418 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCGCTCCCGGTAAATAATGTGG -3'
(R):5'- TGGAACTTGATCTGGACCTTGAACG -3'

Sequencing Primer
(F):5'- CCGGTAAATAATGTGGTATTGGGTC -3'
(R):5'- CTAGAACGGGACCTTGAAGCTC -3'
Posted On 2014-01-29