Incidental Mutation 'R1292:Pik3ca'
ID150807
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
SynonymscaPI3K, 6330412C24Rik, p110alpha
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32397671-32468486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32454420 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 779 (L779Q)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
Predicted Effect probably damaging
Transcript: ENSMUST00000029201
AA Change: L779Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: L779Q

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108242
AA Change: L657Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: L657Q

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108243
AA Change: L779Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: L779Q

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192994
Meta Mutation Damage Score 0.7519 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32462584 missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32450026 missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32459935 missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32439886 missense probably benign 0.27
IGL03401:Pik3ca APN 3 32437814 splice site probably null
Peninsular UTSW 3 32462821 missense probably benign 0.38
R0084:Pik3ca UTSW 3 32462788 missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32459945 missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32439753 missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32461511 missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32450261 critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32436552 missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32450027 missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32456093 missense probably damaging 0.99
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32461841 missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32450350 missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32443867 missense probably benign 0.27
R1969:Pik3ca UTSW 3 32451754 critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32450057 missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32437927 missense possibly damaging 0.65
R2366:Pik3ca UTSW 3 32462794 nonsense probably null
R2680:Pik3ca UTSW 3 32436548 nonsense probably null
R2680:Pik3ca UTSW 3 32443885 missense probably benign 0.00
R3001:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32462797 missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32439935 nonsense probably null
R4416:Pik3ca UTSW 3 32461530 missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32437978 missense probably benign 0.20
R4822:Pik3ca UTSW 3 32437982 missense probably benign 0.04
R4856:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32437163 missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32450053 missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32461560 missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32462779 missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32461563 missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32440714 critical splice donor site probably null
R6347:Pik3ca UTSW 3 32462821 missense probably benign 0.38
R6538:Pik3ca UTSW 3 32439704 missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32436279 missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32436218 missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32443613 nonsense probably null
R8218:Pik3ca UTSW 3 32437847 missense possibly damaging 0.74
Z1177:Pik3ca UTSW 3 32437967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTCAGGTAAGGTTAAGGCCCC -3'
(R):5'- TGCACTCCCTAACGGTTAAACGG -3'

Sequencing Primer
(F):5'- AAGGTTAAGGCCCCTTGTTG -3'
(R):5'- CTAACGGTTAAACGGTTGCC -3'
Posted On2014-01-29