Incidental Mutation 'R1292:Rhbdl2'
ID 150809
Institutional Source Beutler Lab
Gene Symbol Rhbdl2
Ensembl Gene ENSMUSG00000043333
Gene Name rhomboid like 2
Synonyms
MMRRC Submission 039358-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1292 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 123681667-123723697 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123723435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 280 (A280T)
Ref Sequence ENSEMBL: ENSMUSP00000101810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053202] [ENSMUST00000106204]
AlphaFold A2AGA4
Predicted Effect possibly damaging
Transcript: ENSMUST00000053202
AA Change: A280T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054546
Gene: ENSMUSG00000043333
AA Change: A280T

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 7.1e-39 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106204
AA Change: A280T

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101810
Gene: ENSMUSG00000043333
AA Change: A280T

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Rhomboid 113 268 1.8e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137546
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,336,919 (GRCm39) D74E probably benign Het
Abcb1a A T 5: 8,763,343 (GRCm39) T624S probably benign Het
Atp8b1 T C 18: 64,704,092 (GRCm39) Y342C probably damaging Het
Clcnka A G 4: 141,122,903 (GRCm39) probably benign Het
Cma2 C T 14: 56,211,199 (GRCm39) R164C probably damaging Het
Cnga1 T C 5: 72,762,026 (GRCm39) D496G probably damaging Het
Ctbp2 T A 7: 132,616,918 (GRCm39) R6W probably damaging Het
Cyp3a11 T C 5: 145,802,804 (GRCm39) T230A probably benign Het
Defb40 A C 8: 19,028,080 (GRCm39) I18S probably benign Het
Fcgbpl1 A C 7: 27,842,219 (GRCm39) probably benign Het
Gm10036 T G 18: 15,966,368 (GRCm39) I173S possibly damaging Het
Herc2 A T 7: 55,846,951 (GRCm39) I3634L probably benign Het
Igfbp1 A G 11: 7,150,863 (GRCm39) N218S probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Kmt2a A T 9: 44,725,991 (GRCm39) probably benign Het
Ly9 T C 1: 171,416,671 (GRCm39) probably null Het
Mmut C A 17: 41,252,298 (GRCm39) A280E probably damaging Het
Or5k16 C T 16: 58,736,134 (GRCm39) R290K probably damaging Het
Or6k6 A G 1: 173,945,420 (GRCm39) F54S probably benign Het
Pcdhb13 T C 18: 37,576,885 (GRCm39) V421A probably benign Het
Pik3ca T A 3: 32,508,569 (GRCm39) L779Q probably damaging Het
Plxnd1 T C 6: 115,939,644 (GRCm39) probably benign Het
Prss16 T A 13: 22,193,691 (GRCm39) K35* probably null Het
Slc2a2 C T 3: 28,771,637 (GRCm39) T189I probably damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
Tacr1 A G 6: 82,531,856 (GRCm39) I251V probably damaging Het
Tln1 A G 4: 43,534,578 (GRCm39) probably null Het
Vdac3-ps1 T C 13: 18,205,880 (GRCm39) noncoding transcript Het
Zfp458 A T 13: 67,404,754 (GRCm39) C562S probably damaging Het
Other mutations in Rhbdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rhbdl2 APN 4 123,723,450 (GRCm39) missense probably benign
IGL02111:Rhbdl2 APN 4 123,716,630 (GRCm39) missense probably damaging 1.00
IGL03381:Rhbdl2 APN 4 123,716,610 (GRCm39) missense possibly damaging 0.84
IGL03410:Rhbdl2 APN 4 123,723,463 (GRCm39) nonsense probably null
R0039:Rhbdl2 UTSW 4 123,703,822 (GRCm39) missense probably benign 0.02
R2024:Rhbdl2 UTSW 4 123,720,665 (GRCm39) missense probably damaging 1.00
R2120:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R4364:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4366:Rhbdl2 UTSW 4 123,703,728 (GRCm39) start codon destroyed probably null 0.87
R4413:Rhbdl2 UTSW 4 123,703,880 (GRCm39) missense probably benign 0.04
R4749:Rhbdl2 UTSW 4 123,720,694 (GRCm39) critical splice donor site probably null
R5069:Rhbdl2 UTSW 4 123,711,710 (GRCm39) nonsense probably null
R5303:Rhbdl2 UTSW 4 123,704,014 (GRCm39) intron probably benign
R5951:Rhbdl2 UTSW 4 123,708,120 (GRCm39) missense probably benign 0.00
R7147:Rhbdl2 UTSW 4 123,703,908 (GRCm39) missense probably damaging 1.00
R7171:Rhbdl2 UTSW 4 123,708,049 (GRCm39) missense possibly damaging 0.95
R7337:Rhbdl2 UTSW 4 123,711,659 (GRCm39) missense possibly damaging 0.91
R7374:Rhbdl2 UTSW 4 123,711,658 (GRCm39) missense probably benign 0.01
R7411:Rhbdl2 UTSW 4 123,723,435 (GRCm39) missense possibly damaging 0.69
R7718:Rhbdl2 UTSW 4 123,718,712 (GRCm39) missense probably damaging 1.00
R8152:Rhbdl2 UTSW 4 123,718,711 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTTGCGCTGGAGTAGGAGATCCAC -3'
(R):5'- CCTATTGTAAGCTCAGTCGCTGTCC -3'

Sequencing Primer
(F):5'- GTAGGAGATCCACAGCTAAAATATAC -3'
(R):5'- ggctgacctggaactcac -3'
Posted On 2014-01-29