Incidental Mutation 'R1292:Clcnka'
ID150810
Institutional Source Beutler Lab
Gene Symbol Clcnka
Ensembl Gene ENSMUSG00000033770
Gene Namechloride channel, voltage-sensitive Ka
SynonymsCLC-K1, Clcnk1
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141384610-141398724 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 141395592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042617] [ENSMUST00000105790] [ENSMUST00000133676]
Predicted Effect probably benign
Transcript: ENSMUST00000042617
SMART Domains Protein: ENSMUSP00000048520
Gene: ENSMUSG00000033770

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 102 514 2.1e-69 PFAM
CBS 554 604 6.54e-6 SMART
Pfam:CBS 623 679 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105790
SMART Domains Protein: ENSMUSP00000101416
Gene: ENSMUSG00000033770

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 514 3.1e-75 PFAM
CBS 554 604 6.54e-6 SMART
Blast:CBS 629 678 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133676
SMART Domains Protein: ENSMUSP00000122396
Gene: ENSMUSG00000033770

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 191 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150334
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This gene is a member of the CLC family of voltage-gated chloride channels. The gene is located adjacent to a highly similar chloride channel gene on chromosome 4. This gene is syntenic with human CLCNKB (geneID:1188). Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased urine volume and decreased urine osmolarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Clcnka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Clcnka APN 4 141391401 nonsense probably null
IGL01420:Clcnka APN 4 141389332 missense probably benign 0.00
IGL01726:Clcnka APN 4 141392740 critical splice donor site probably null
IGL02676:Clcnka APN 4 141392783 missense probably damaging 0.97
IGL02983:Clcnka APN 4 141390131 missense probably damaging 0.99
IGL03182:Clcnka APN 4 141394487 missense probably damaging 1.00
free_trade UTSW 4 141395158 nonsense probably null
R0646:Clcnka UTSW 4 141396606 missense probably benign
R1479:Clcnka UTSW 4 141389447 missense possibly damaging 0.82
R1864:Clcnka UTSW 4 141392802 missense probably damaging 0.99
R3806:Clcnka UTSW 4 141387290 missense probably null 0.05
R5035:Clcnka UTSW 4 141395158 nonsense probably null
R5617:Clcnka UTSW 4 141389317 missense probably null 0.01
R5869:Clcnka UTSW 4 141394965 missense probably benign 0.08
R6048:Clcnka UTSW 4 141394487 missense probably damaging 1.00
R7042:Clcnka UTSW 4 141391380 missense probably damaging 0.97
R7068:Clcnka UTSW 4 141387110 missense probably damaging 0.99
R8016:Clcnka UTSW 4 141390152 missense possibly damaging 0.85
R8292:Clcnka UTSW 4 141397961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGTCTTAGGCCAACCCCAAACG -3'
(R):5'- AAGAGTAGCCTTTAGCCTCAGCCC -3'

Sequencing Primer
(F):5'- CAACCCCAAACGCCAGG -3'
(R):5'- agagagagagaaagagagagagag -3'
Posted On2014-01-29