Incidental Mutation 'R1292:Tacr1'
ID150814
Institutional Source Beutler Lab
Gene Symbol Tacr1
Ensembl Gene ENSMUSG00000030043
Gene Nametachykinin receptor 1
Synonymssubstance p receptor, Tac1r, NK1 receptor, SPr, NK1-R, neurokinin receptor 1, NK-1R
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location82402334-82560104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82554875 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 251 (I251V)
Ref Sequence ENSEMBL: ENSMUSP00000145217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032122] [ENSMUST00000203775]
Predicted Effect probably damaging
Transcript: ENSMUST00000032122
AA Change: I251V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032122
Gene: ENSMUSG00000030043
AA Change: I251V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203775
AA Change: I251V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145217
Gene: ENSMUSG00000030043
AA Change: I251V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Meta Mutation Damage Score 0.1480 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This gene encodes the receptor for the tachykinin, substance P, also referred to as neurokinin 1. This gene belongs to a gene family of tachykinin receptors which are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This receptor has been associated with nitric oxide formation, and it has been localized to cholinergic and nitrergic neurons as well as on smooth muscle cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced anxiety, pain and stress-related responses, reduced immunological response after a viral challenge, and reduced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Tacr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Tacr1 APN 6 82403655 missense probably benign 0.01
IGL01875:Tacr1 APN 6 82557016 missense probably benign 0.18
IGL02092:Tacr1 APN 6 82403919 missense probably damaging 1.00
IGL02506:Tacr1 APN 6 82403758 missense probably damaging 1.00
IGL02651:Tacr1 APN 6 82492641 missense probably damaging 0.98
R0627:Tacr1 UTSW 6 82555031 missense possibly damaging 0.93
R0732:Tacr1 UTSW 6 82552901 missense probably damaging 1.00
R1279:Tacr1 UTSW 6 82557183 nonsense probably null
R1480:Tacr1 UTSW 6 82492530 missense possibly damaging 0.47
R1595:Tacr1 UTSW 6 82403742 missense probably benign 0.05
R2061:Tacr1 UTSW 6 82492554 missense probably damaging 0.96
R2260:Tacr1 UTSW 6 82403775 missense probably damaging 1.00
R2697:Tacr1 UTSW 6 82492597 missense probably damaging 1.00
R2941:Tacr1 UTSW 6 82403734 missense probably damaging 1.00
R4629:Tacr1 UTSW 6 82403880 missense probably benign 0.02
R4780:Tacr1 UTSW 6 82557072 missense probably benign
R4916:Tacr1 UTSW 6 82554941 missense probably benign 0.00
R5065:Tacr1 UTSW 6 82554878 missense possibly damaging 0.94
R5801:Tacr1 UTSW 6 82557153 missense probably benign 0.04
R6919:Tacr1 UTSW 6 82557073 missense probably benign 0.03
R6941:Tacr1 UTSW 6 82403865 missense possibly damaging 0.75
R7269:Tacr1 UTSW 6 82492711 missense probably benign
Z1177:Tacr1 UTSW 6 82554997 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TACAGTCCTCTGAAGGGTTCCTGC -3'
(R):5'- GCACGGTCTACTCACCTGTCATTG -3'

Sequencing Primer
(F):5'- ggcatagcaatgatggcag -3'
(R):5'- TCACCTGTCATTGAGGCAGC -3'
Posted On2014-01-29