Incidental Mutation 'R1292:Ctbp2'
ID150818
Institutional Source Beutler Lab
Gene Symbol Ctbp2
Ensembl Gene ENSMUSG00000030970
Gene NameC-terminal binding protein 2
SynonymsD7Ertd45e, Gtrgeo6, Ribeye
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1292 (G1)
Quality Score210
Status Validated
Chromosome7
Chromosomal Location132987563-133124354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133015189 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 6 (R6W)
Ref Sequence ENSEMBL: ENSMUSP00000126126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033269] [ENSMUST00000124096] [ENSMUST00000163601] [ENSMUST00000165457] [ENSMUST00000166439] [ENSMUST00000167218] [ENSMUST00000168958] [ENSMUST00000169570] [ENSMUST00000170459] [ENSMUST00000172341]
Predicted Effect probably benign
Transcript: ENSMUST00000033269
SMART Domains Protein: ENSMUSP00000033269
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 358 2.9e-31 PFAM
Pfam:2-Hacid_dh_C 139 323 1.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164739
SMART Domains Protein: ENSMUSP00000130157
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164896
SMART Domains Protein: ENSMUSP00000129195
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165457
AA Change: R6W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165534
SMART Domains Protein: ENSMUSP00000132311
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166400
SMART Domains Protein: ENSMUSP00000131868
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166439
SMART Domains Protein: ENSMUSP00000127448
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 11 333 2.4e-31 PFAM
Pfam:2-Hacid_dh_C 114 298 1.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167218
AA Change: R6W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000168958
SMART Domains Protein: ENSMUSP00000132892
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 19 164 6.3e-27 PFAM
Pfam:2-Hacid_dh_C 122 188 8.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169570
AA Change: R6W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130294
Gene: ENSMUSG00000030970
AA Change: R6W

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 579 901 2.8e-31 PFAM
Pfam:2-Hacid_dh_C 682 866 5.6e-57 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170459
AA Change: R6W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171727
SMART Domains Protein: ENSMUSP00000127123
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172341
SMART Domains Protein: ENSMUSP00000127701
Gene: ENSMUSG00000030970

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 36 177 5.6e-27 PFAM
Meta Mutation Damage Score 0.1679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3; however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Embryos homozygous for a gene-trapped allele die by E10 exhibiting a small size, axial truncations, a thin neural epithelium, a dilated pericardium, delayed fore- and midbrain development, and defects in heart morphogenesis, placental development and extraembryonic vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Ctbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Ctbp2 APN 7 132991156 missense probably damaging 0.98
IGL02615:Ctbp2 APN 7 132995347 missense probably benign 0.34
IGL02626:Ctbp2 APN 7 132999211 missense probably benign 0.12
PIT4802001:Ctbp2 UTSW 7 132988245 missense possibly damaging 0.77
R0068:Ctbp2 UTSW 7 132990059 missense possibly damaging 0.95
R0374:Ctbp2 UTSW 7 132999344 missense possibly damaging 0.89
R0566:Ctbp2 UTSW 7 132991147 missense probably damaging 1.00
R0571:Ctbp2 UTSW 7 133014805 missense probably damaging 1.00
R1247:Ctbp2 UTSW 7 132995189 missense probably benign 0.24
R1477:Ctbp2 UTSW 7 132998941 missense probably damaging 1.00
R1732:Ctbp2 UTSW 7 132998924 missense possibly damaging 0.80
R1807:Ctbp2 UTSW 7 133014408 missense probably benign 0.00
R1865:Ctbp2 UTSW 7 132990554 missense probably benign 0.02
R1951:Ctbp2 UTSW 7 133015027 missense probably benign
R2393:Ctbp2 UTSW 7 133023561 critical splice donor site probably null
R2410:Ctbp2 UTSW 7 133014354 missense probably benign 0.08
R3427:Ctbp2 UTSW 7 132991592 missense probably damaging 1.00
R4004:Ctbp2 UTSW 7 132991773 missense probably benign 0.31
R4243:Ctbp2 UTSW 7 132998854 missense probably benign 0.43
R4754:Ctbp2 UTSW 7 133023558 splice site probably null
R4820:Ctbp2 UTSW 7 133013694 missense probably damaging 0.98
R4947:Ctbp2 UTSW 7 132999283 missense probably damaging 1.00
R4960:Ctbp2 UTSW 7 133014238 missense probably benign 0.00
R4999:Ctbp2 UTSW 7 133014649 missense possibly damaging 0.62
R5340:Ctbp2 UTSW 7 133013963 missense probably benign 0.43
R5593:Ctbp2 UTSW 7 132998869 missense possibly damaging 0.95
R5762:Ctbp2 UTSW 7 132995359 missense probably damaging 1.00
R6913:Ctbp2 UTSW 7 133014726 missense possibly damaging 0.94
R7044:Ctbp2 UTSW 7 133015102 missense possibly damaging 0.71
R7342:Ctbp2 UTSW 7 133014312 missense probably damaging 0.99
R7358:Ctbp2 UTSW 7 132998881 missense probably damaging 1.00
R7376:Ctbp2 UTSW 7 133013968 missense possibly damaging 0.93
R7393:Ctbp2 UTSW 7 132988292 missense probably benign 0.17
R7678:Ctbp2 UTSW 7 133014624 missense probably benign
R7709:Ctbp2 UTSW 7 132990060 missense probably benign
R7900:Ctbp2 UTSW 7 133014599 missense probably benign
R8018:Ctbp2 UTSW 7 133014366 missense probably benign 0.38
Z1176:Ctbp2 UTSW 7 133015290 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCTGTCGTAGAAGGTGAAGTC -3'
(R):5'- GGTCGTGCCTTGAAACAGAAACCC -3'

Sequencing Primer
(F):5'- GCCAGTGAGTTATAAAAAGCTTCCC -3'
(R):5'- CAGAAACCCCCAGTTGTTTG -3'
Posted On2014-01-29