Incidental Mutation 'R1292:Igfbp1'
ID150822
Institutional Source Beutler Lab
Gene Symbol Igfbp1
Ensembl Gene ENSMUSG00000020429
Gene Nameinsulin-like growth factor binding protein 1
SynonymsIGFBP-1
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location7197782-7202546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7200863 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 218 (N218S)
Ref Sequence ENSEMBL: ENSMUSP00000020704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020704]
Predicted Effect probably damaging
Transcript: ENSMUST00000020704
AA Change: N218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020704
Gene: ENSMUSG00000020429
AA Change: N218S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IB 30 108 2.18e-29 SMART
TY 216 268 8.86e-20 SMART
Meta Mutation Damage Score 0.7288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene desplay a grossly normal phenotype but are more susceptible to liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Igfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0284:Igfbp1 UTSW 11 7198103 missense probably damaging 1.00
R1696:Igfbp1 UTSW 11 7197978 missense probably benign 0.30
R1696:Igfbp1 UTSW 11 7201922 missense probably damaging 1.00
R2940:Igfbp1 UTSW 11 7201970 missense probably benign 0.00
R4060:Igfbp1 UTSW 11 7198091 missense probably damaging 1.00
R5276:Igfbp1 UTSW 11 7201892 missense probably damaging 1.00
R5308:Igfbp1 UTSW 11 7199919 critical splice donor site probably null
R8103:Igfbp1 UTSW 11 7198106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACAGTCCTAGAATACCGTGCC -3'
(R):5'- GGACTAGCTTTTCCCAACTGCTGC -3'

Sequencing Primer
(F):5'- AATACCGTGCCTCGGTGG -3'
(R):5'- CAGGGCTGGATCTCAGAAAGC -3'
Posted On2014-01-29