Incidental Mutation 'R1292:Prss16'
ID150824
Institutional Source Beutler Lab
Gene Symbol Prss16
Ensembl Gene ENSMUSG00000006179
Gene Nameprotease, serine 16 (thymus)
SynonymsTSSP
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22002173-22009742 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22009521 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 35 (K35*)
Ref Sequence ENSEMBL: ENSMUSP00000006341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]
Predicted Effect probably null
Transcript: ENSMUST00000006341
AA Change: K35*
SMART Domains Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179
AA Change: K35*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:Peptidase_S28 63 493 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147811
Predicted Effect probably benign
Transcript: ENSMUST00000150547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223857
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Prss16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Prss16 APN 13 22003021 missense probably damaging 0.99
IGL02272:Prss16 APN 13 22003035 missense probably damaging 0.96
IGL02383:Prss16 APN 13 22009527 missense probably benign 0.00
IGL02892:Prss16 APN 13 22003050 missense probably benign 0.03
IGL03325:Prss16 APN 13 22003247 missense possibly damaging 0.90
BB001:Prss16 UTSW 13 22008664 missense probably damaging 0.99
BB011:Prss16 UTSW 13 22008664 missense probably damaging 0.99
R0645:Prss16 UTSW 13 22009376 unclassified probably benign
R0970:Prss16 UTSW 13 22005117 missense probably damaging 1.00
R1146:Prss16 UTSW 13 22006968 unclassified probably benign
R1371:Prss16 UTSW 13 22008686 unclassified probably benign
R1525:Prss16 UTSW 13 22009443 missense possibly damaging 0.50
R1624:Prss16 UTSW 13 22003313 missense probably benign 0.31
R2233:Prss16 UTSW 13 22009409 missense possibly damaging 0.70
R5147:Prss16 UTSW 13 22006094 missense possibly damaging 0.70
R5670:Prss16 UTSW 13 22003051 missense possibly damaging 0.74
R6440:Prss16 UTSW 13 22003160 missense probably damaging 0.97
R6668:Prss16 UTSW 13 22006748 missense probably null 0.01
R6791:Prss16 UTSW 13 22006067 missense probably damaging 0.99
R7278:Prss16 UTSW 13 22003147 missense probably damaging 1.00
R7924:Prss16 UTSW 13 22008664 missense probably damaging 0.99
Z1176:Prss16 UTSW 13 22006054 nonsense probably null
Z1176:Prss16 UTSW 13 22006400 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCTGGGGTTACAGACTGACAAGAC -3'
(R):5'- GTTACTACTGACGCTGAACCTGCC -3'

Sequencing Primer
(F):5'- TTACAGACTGACAAGACAGTGC -3'
(R):5'- AGAGTGCCTGGAACACTTC -3'
Posted On2014-01-29