Mutagenetix > Incidental Mutations

Incidental Mutation 'R1292:Pcdhb13'

150830

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb13

Ensembl Gene

ENSMUSG00000047307

Gene Name

protocadherin beta 13

Synonyms

PcdhbM, Pcdbh6

MMRRC Submission

039358-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R1292 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37442500-37446209 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37443832 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 421 (V421A)

Ref Sequence

ENSEMBL: ENSMUSP00000061087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]

Predicted Effect

probably benign
Transcript: ENSMUST00000052387

SMART Domains

Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043

Domain	Start	End	E-Value	Type
Pfam:Cadherin_2	30	112	1.4e-35	PFAM
CA	155	240	1.53e-20	SMART
CA	264	345	3.52e-29	SMART
CA	368	449	2.24e-22	SMART
CA	473	559	2.38e-26	SMART
CA	589	670	4.12e-12	SMART
Pfam:Cadherin_C_2	685	768	4.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000056915
AA Change: V421A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307
AA Change: V421A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	58	130	5.5e-1	SMART
CA	154	239	8.55e-19	SMART
CA	263	343	3.36e-26	SMART
CA	366	447	2.24e-22	SMART
CA	471	557	1.08e-24	SMART
CA	587	668	1.25e-11	SMART
Pfam:Cadherin_C_2	685	768	2.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Meta Mutation Damage Score

0.2662

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.7%

Validation Efficiency

97% (31/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. Unlike the alpha and gamma clusters, the transcripts from these genes do not share common 3' exons. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell neural connections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930550C14Rik	T	A	9: 53,425,619	D74E	probably benign	Het
9530053A07Rik	A	C	7: 28,142,794		probably benign	Het
Abcb1a	A	T	5: 8,713,343	T624S	probably benign	Het
Atp8b1	T	C	18: 64,571,021	Y342C	probably damaging	Het
Clcnka	A	G	4: 141,395,592		probably benign	Het
Cma2	C	T	14: 55,973,742	R164C	probably damaging	Het
Cnga1	T	C	5: 72,604,683	D496G	probably damaging	Het
Ctbp2	T	A	7: 133,015,189	R6W	probably damaging	Het
Cyp3a11	T	C	5: 145,865,994	T230A	probably benign	Het
Defb40	A	C	8: 18,978,064	I18S	probably benign	Het
Gm10036	T	G	18: 15,833,311	I173S	possibly damaging	Het
Herc2	A	T	7: 56,197,203	I3634L	probably benign	Het
Igfbp1	A	G	11: 7,200,863	N218S	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Kmt2a	A	T	9: 44,814,694		probably benign	Het
Ly9	T	C	1: 171,589,103		probably null	Het
Mut	C	A	17: 40,941,407	A280E	probably damaging	Het
Olfr180	C	T	16: 58,915,771	R290K	probably damaging	Het
Olfr231	A	G	1: 174,117,854	F54S	probably benign	Het
Pik3ca	T	A	3: 32,454,420	L779Q	probably damaging	Het
Plxnd1	T	C	6: 115,962,683		probably benign	Het
Prss16	T	A	13: 22,009,521	K35*	probably null	Het
Rhbdl2	G	A	4: 123,829,642	A280T	possibly damaging	Het
Slc2a2	C	T	3: 28,717,488	T189I	probably damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Tacr1	A	G	6: 82,554,875	I251V	probably damaging	Het
Tln1	A	G	4: 43,534,578		probably null	Het
Vdac3-ps1	T	C	13: 18,031,295		noncoding transcript	Het
Zfp458	A	T	13: 67,256,690	C562S	probably damaging	Het

Other mutations in Pcdhb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00654:Pcdhb13	APN	18	37443721	missense	possibly damaging	0.56
IGL00718:Pcdhb13	APN	18	37444821	missense	possibly damaging	0.91
IGL01143:Pcdhb13	APN	18	37442637	missense	probably benign	0.01
IGL01816:Pcdhb13	APN	18	37442975	missense	probably benign	0.00
IGL01916:Pcdhb13	APN	18	37443861	missense	possibly damaging	0.64
IGL02063:Pcdhb13	APN	18	37444229	missense	probably damaging	1.00
IGL02153:Pcdhb13	APN	18	37443685	missense	probably damaging	1.00
IGL02332:Pcdhb13	APN	18	37443582	missense	probably benign	0.32
IGL02407:Pcdhb13	APN	18	37443075	missense	probably damaging	1.00
IGL02423:Pcdhb13	APN	18	37444339	missense	possibly damaging	0.95
IGL02514:Pcdhb13	APN	18	37442991	missense	possibly damaging	0.80
IGL03025:Pcdhb13	APN	18	37442764	missense	probably damaging	1.00
IGL03227:Pcdhb13	APN	18	37443658	missense	probably damaging	0.98
IGL03233:Pcdhb13	APN	18	37444265	missense	probably damaging	0.96
IGL03239:Pcdhb13	APN	18	37442835	missense	probably damaging	0.97
R0046:Pcdhb13	UTSW	18	37444257	missense	probably benign
R0172:Pcdhb13	UTSW	18	37442937	missense	probably benign	0.00
R0201:Pcdhb13	UTSW	18	37442581	missense	probably benign
R0594:Pcdhb13	UTSW	18	37443931	missense	probably damaging	1.00
R1235:Pcdhb13	UTSW	18	37444959	makesense	probably null
R1481:Pcdhb13	UTSW	18	37442836	missense	probably damaging	1.00
R1991:Pcdhb13	UTSW	18	37443859	missense	possibly damaging	0.80
R2058:Pcdhb13	UTSW	18	37444567	missense	possibly damaging	0.95
R3508:Pcdhb13	UTSW	18	37443151	missense	probably damaging	0.99
R3713:Pcdhb13	UTSW	18	37443733	missense	probably damaging	1.00
R4125:Pcdhb13	UTSW	18	37443820	missense	probably damaging	1.00
R4741:Pcdhb13	UTSW	18	37443518	missense	probably benign	0.01
R4747:Pcdhb13	UTSW	18	37444815	missense	probably damaging	0.99
R4957:Pcdhb13	UTSW	18	37444784	missense	possibly damaging	0.95
R4973:Pcdhb13	UTSW	18	37443184	missense	probably benign	0.20
R5354:Pcdhb13	UTSW	18	37444791	missense	probably damaging	1.00
R5364:Pcdhb13	UTSW	18	37443508	missense	probably damaging	1.00
R5544:Pcdhb13	UTSW	18	37443520	missense	possibly damaging	0.92
R5897:Pcdhb13	UTSW	18	37443211	missense	probably benign	0.42
R6174:Pcdhb13	UTSW	18	37443421	missense	possibly damaging	0.84
R6702:Pcdhb13	UTSW	18	37444775	missense	probably benign	0.42
R6765:Pcdhb13	UTSW	18	37443610	missense	probably damaging	1.00
R6960:Pcdhb13	UTSW	18	37443456	missense	probably benign	0.45
R7144:Pcdhb13	UTSW	18	37443256	missense	probably damaging	1.00
R7225:Pcdhb13	UTSW	18	37444437	missense	possibly damaging	0.91
R7239:Pcdhb13	UTSW	18	37444644	missense	probably damaging	0.99
R7437:Pcdhb13	UTSW	18	37444675	missense	probably damaging	1.00
R7812:Pcdhb13	UTSW	18	37442592	missense	probably benign	0.00
R7964:Pcdhb13	UTSW	18	37444818	missense	possibly damaging	0.62
R8334:Pcdhb13	UTSW	18	37444800	missense	probably damaging	1.00
R8463:Pcdhb13	UTSW	18	37443234	missense	possibly damaging	0.94
R8476:Pcdhb13	UTSW	18	37444084	missense	probably damaging	1.00
R8501:Pcdhb13	UTSW	18	37444440	missense	probably damaging	1.00
X0023:Pcdhb13	UTSW	18	37443013	missense	probably damaging	1.00
X0028:Pcdhb13	UTSW	18	37444642	missense	possibly damaging	0.91
Z1176:Pcdhb13	UTSW	18	37443235	nonsense	probably null
Z1177:Pcdhb13	UTSW	18	37442580	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACGCTCCAGAAGTGATCCTATCCTC -3'
(R):5'- CCTGAATCTGAGTCTGTGGCACTG -3'

Sequencing Primer
(F):5'- CCAGGTATCATAGTGGCAGTATTCAG -3'
(R):5'- CACTGATGGTGCCTATGTGC -3'

Posted On

2014-01-29