Incidental Mutation 'R1274:Rgs20'
ID150832
Institutional Source Beutler Lab
Gene Symbol Rgs20
Ensembl Gene ENSMUSG00000002459
Gene Nameregulator of G-protein signaling 20
SynonymsRgsz1, 2900073E09Rik
MMRRC Submission 039340-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1274 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location4909576-5070285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4912447 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 166 (T166I)
Ref Sequence ENSEMBL: ENSMUSP00000117380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002533] [ENSMUST00000118000] [ENSMUST00000119256] [ENSMUST00000147158] [ENSMUST00000170566]
Predicted Effect probably damaging
Transcript: ENSMUST00000002533
AA Change: T133I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002533
Gene: ENSMUSG00000002459
AA Change: T133I

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
RGS 113 229 2.09e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118000
AA Change: T266I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113398
Gene: ENSMUSG00000002459
AA Change: T266I

DomainStartEndE-ValueType
low complexity region 123 135 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
RGS 246 362 2.09e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119256
AA Change: T102I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113324
Gene: ENSMUSG00000002459
AA Change: T102I

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 82 198 2.09e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147158
AA Change: T166I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117380
Gene: ENSMUSG00000002459
AA Change: T166I

DomainStartEndE-ValueType
low complexity region 92 104 N/A INTRINSIC
Pfam:RGS 146 200 2.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170566
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 T C 19: 56,914,563 D728G probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ceacam3 A G 7: 17,163,139 R677G probably damaging Het
Col16a1 T A 4: 130,097,801 M1431K probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm11487 T C 4: 73,403,076 Y148C probably damaging Het
Gm6563 A T 19: 23,676,337 I164F probably benign Het
Nav2 C A 7: 49,604,430 Y2325* probably null Het
Olfr1163 A C 2: 88,070,595 C262W probably damaging Het
Olfr1335 T C 4: 118,809,396 N156S probably benign Het
P2ry12 T C 3: 59,217,220 T345A possibly damaging Het
Ptpn13 C T 5: 103,550,260 P1078S probably damaging Het
Sik1 A T 17: 31,846,575 L683Q possibly damaging Het
Slc7a5 C T 8: 121,883,714 V454M probably benign Het
Snx30 A G 4: 59,885,133 T258A probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Other mutations in Rgs20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Rgs20 APN 1 5070015 missense probably benign 0.04
IGL01433:Rgs20 APN 1 5070077 missense possibly damaging 0.85
IGL01691:Rgs20 APN 1 4916922 missense probably benign 0.00
R0573:Rgs20 UTSW 1 5020814 missense possibly damaging 0.85
R1305:Rgs20 UTSW 1 5021039 unclassified probably null
R1513:Rgs20 UTSW 1 4912337 missense probably damaging 1.00
R1568:Rgs20 UTSW 1 5020827 missense probably benign 0.00
R1763:Rgs20 UTSW 1 4910640 missense probably damaging 1.00
R1794:Rgs20 UTSW 1 4910572 missense probably damaging 1.00
R2118:Rgs20 UTSW 1 4916890 splice site probably benign
R2437:Rgs20 UTSW 1 5070147 splice site probably null
R3029:Rgs20 UTSW 1 5070053 missense probably benign 0.00
R4665:Rgs20 UTSW 1 5021008 missense probably benign 0.00
R5014:Rgs20 UTSW 1 4910547 missense probably damaging 1.00
R5433:Rgs20 UTSW 1 5070110 missense possibly damaging 0.93
R5620:Rgs20 UTSW 1 4912443 missense probably damaging 1.00
R5880:Rgs20 UTSW 1 4923881 missense probably damaging 0.99
R5990:Rgs20 UTSW 1 4912330 missense probably benign 0.11
R6188:Rgs20 UTSW 1 5020883 frame shift probably null
R7323:Rgs20 UTSW 1 4912312 critical splice donor site probably null
R7459:Rgs20 UTSW 1 4910634 missense probably benign 0.04
R7467:Rgs20 UTSW 1 4912330 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CGGCAGTTTAGCGATGGCTCTAATG -3'
(R):5'- AAACGGTGCTCTCCCTTCCCAAAG -3'

Sequencing Primer
(F):5'- TTAGCGATGGCTCTAATGAGACAC -3'
(R):5'- TATCAGAGATGGAAAGCTATGTGAC -3'
Posted On2014-01-29