Incidental Mutation 'R1274:P2ry12'
ID150835
Institutional Source Beutler Lab
Gene Symbol P2ry12
Ensembl Gene ENSMUSG00000036353
Gene Namepurinergic receptor P2Y, G-protein coupled 12
Synonyms2900079B22Rik, P2Y12, 4921504D23Rik
MMRRC Submission 039340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1274 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59216272-59262871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59217220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 345 (T345A)
Ref Sequence ENSEMBL: ENSMUSP00000143521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000170388] [ENSMUST00000196583] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199675]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050360
AA Change: T345A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353
AA Change: T345A

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170388
AA Change: T345A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126819
Gene: ENSMUSG00000036353
AA Change: T345A

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196583
AA Change: T345A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143036
Gene: ENSMUSG00000036353
AA Change: T345A

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199609
AA Change: T345A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353
AA Change: T345A

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199675
SMART Domains Protein: ENSMUSP00000143706
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
PDB:4PY0|A 2 116 5e-59 PDB
SCOP:d1l9ha_ 3 116 8e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is involved in platelet aggregation, and is a potential target for the treatment of thromboembolisms and other clotting disorders. Mutations in this gene are implicated in bleeding disorder, platelet type 8 (BDPLT8). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in impaired platelet activation, increased bleeding time and delayed thrombus formation in injured arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 T C 19: 56,914,563 D728G probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ceacam3 A G 7: 17,163,139 R677G probably damaging Het
Col16a1 T A 4: 130,097,801 M1431K probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm11487 T C 4: 73,403,076 Y148C probably damaging Het
Gm6563 A T 19: 23,676,337 I164F probably benign Het
Nav2 C A 7: 49,604,430 Y2325* probably null Het
Olfr1163 A C 2: 88,070,595 C262W probably damaging Het
Olfr1335 T C 4: 118,809,396 N156S probably benign Het
Ptpn13 C T 5: 103,550,260 P1078S probably damaging Het
Rgs20 G A 1: 4,912,447 T166I probably damaging Het
Sik1 A T 17: 31,846,575 L683Q possibly damaging Het
Slc7a5 C T 8: 121,883,714 V454M probably benign Het
Snx30 A G 4: 59,885,133 T258A probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Other mutations in P2ry12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:P2ry12 APN 3 59217882 missense probably damaging 1.00
IGL03075:P2ry12 APN 3 59218158 missense probably damaging 1.00
IGL02796:P2ry12 UTSW 3 59217881 missense probably damaging 1.00
R0707:P2ry12 UTSW 3 59217487 missense probably damaging 1.00
R1321:P2ry12 UTSW 3 59217225 missense possibly damaging 0.94
R1513:P2ry12 UTSW 3 59218077 missense probably damaging 1.00
R1781:P2ry12 UTSW 3 59217778 missense probably benign 0.04
R2108:P2ry12 UTSW 3 59217353 missense probably damaging 1.00
R3430:P2ry12 UTSW 3 59218027 missense probably damaging 1.00
R4119:P2ry12 UTSW 3 59217841 missense probably benign 0.00
R4499:P2ry12 UTSW 3 59217657 missense probably damaging 0.97
R4501:P2ry12 UTSW 3 59217657 missense probably damaging 0.97
R4670:P2ry12 UTSW 3 59217904 unclassified probably null
R4823:P2ry12 UTSW 3 59217897 missense probably benign 0.00
R5643:P2ry12 UTSW 3 59218095 missense possibly damaging 0.96
R5644:P2ry12 UTSW 3 59218095 missense possibly damaging 0.96
R6246:P2ry12 UTSW 3 59217529 missense probably benign 0.00
R6261:P2ry12 UTSW 3 59217907 missense probably null 0.87
R6473:P2ry12 UTSW 3 59217511 missense probably benign 0.06
R6484:P2ry12 UTSW 3 59217333 missense probably damaging 1.00
R6654:P2ry12 UTSW 3 59218020 missense probably damaging 1.00
R7151:P2ry12 UTSW 3 59217706 missense probably benign 0.01
R7446:P2ry12 UTSW 3 59217211 makesense probably null
R7676:P2ry12 UTSW 3 59217757 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCAGTATAGCAATGGGATGCAGTTC -3'
(R):5'- AACATGATTCTCACCAACAGGAGGC -3'

Sequencing Primer
(F):5'- CCTGCAGACTAAGATTTTTCCCATA -3'
(R):5'- ACCCTGTTCTACGTGAAGGAG -3'
Posted On2014-01-29