Incidental Mutation 'R1274:Anpep'
ID 150846
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Name alanyl aminopeptidase, membrane
Synonyms aminopeptidase N, Apn, Cd13
MMRRC Submission 039340-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1274 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79471551-79497958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79488004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 518 (E518K)
Ref Sequence ENSEMBL: ENSMUSP00000103015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]
AlphaFold P97449
Predicted Effect probably benign
Transcript: ENSMUST00000049004
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: E518K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107392
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: E518K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149164
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Predicted Effect probably benign
Transcript: ENSMUST00000206235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 T C 19: 56,902,995 (GRCm39) D728G probably benign Het
Ceacam3 A G 7: 16,897,064 (GRCm39) R677G probably damaging Het
Col16a1 T A 4: 129,991,594 (GRCm39) M1431K probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Gm6563 A T 19: 23,653,701 (GRCm39) I164F probably benign Het
Msantd5f6 T C 4: 73,321,313 (GRCm39) Y148C probably damaging Het
Nav2 C A 7: 49,254,178 (GRCm39) Y2325* probably null Het
Or10ak12 T C 4: 118,666,593 (GRCm39) N156S probably benign Het
Or5d36 A C 2: 87,900,939 (GRCm39) C262W probably damaging Het
P2ry12 T C 3: 59,124,641 (GRCm39) T345A possibly damaging Het
Ptpn13 C T 5: 103,698,126 (GRCm39) P1078S probably damaging Het
Rgs20 G A 1: 4,982,670 (GRCm39) T166I probably damaging Het
Sik1 A T 17: 32,065,549 (GRCm39) L683Q possibly damaging Het
Slc7a5 C T 8: 122,610,453 (GRCm39) V454M probably benign Het
Snx30 A G 4: 59,885,133 (GRCm39) T258A probably benign Het
Vmn1r234 CTT CTTT 17: 21,449,513 (GRCm39) probably null Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,749,388 (GRCm39) probably benign Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79,475,484 (GRCm39) missense possibly damaging 0.64
IGL00089:Anpep APN 7 79,491,734 (GRCm39) missense probably damaging 1.00
IGL00767:Anpep APN 7 79,490,638 (GRCm39) missense probably benign 0.00
IGL00901:Anpep APN 7 79,489,171 (GRCm39) missense probably benign
IGL01919:Anpep APN 7 79,475,098 (GRCm39) missense possibly damaging 0.77
IGL02049:Anpep APN 7 79,484,929 (GRCm39) missense probably damaging 0.97
IGL02195:Anpep APN 7 79,476,433 (GRCm39) missense probably damaging 1.00
IGL02210:Anpep APN 7 79,476,652 (GRCm39) missense probably benign 0.00
IGL02584:Anpep APN 7 79,475,141 (GRCm39) splice site probably benign
IGL02677:Anpep APN 7 79,488,478 (GRCm39) missense probably damaging 1.00
IGL03073:Anpep APN 7 79,488,703 (GRCm39) missense probably damaging 1.00
IGL03100:Anpep APN 7 79,486,109 (GRCm39) missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79,489,212 (GRCm39) missense possibly damaging 0.85
R0329:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R0330:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R0619:Anpep UTSW 7 79,490,757 (GRCm39) missense probably benign
R0691:Anpep UTSW 7 79,489,047 (GRCm39) missense probably damaging 0.98
R1004:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1005:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1288:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1289:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1532:Anpep UTSW 7 79,476,696 (GRCm39) nonsense probably null
R1540:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1574:Anpep UTSW 7 79,488,155 (GRCm39) splice site probably null
R1574:Anpep UTSW 7 79,488,155 (GRCm39) splice site probably null
R1618:Anpep UTSW 7 79,485,165 (GRCm39) missense probably benign 0.00
R1627:Anpep UTSW 7 79,491,759 (GRCm39) missense probably benign
R1693:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1717:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1745:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1746:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1748:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1809:Anpep UTSW 7 79,491,571 (GRCm39) missense probably benign 0.01
R1901:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1902:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1903:Anpep UTSW 7 79,488,004 (GRCm39) missense probably benign 0.01
R1985:Anpep UTSW 7 79,490,605 (GRCm39) splice site probably null
R2379:Anpep UTSW 7 79,490,966 (GRCm39) missense probably benign 0.28
R2508:Anpep UTSW 7 79,488,039 (GRCm39) missense possibly damaging 0.80
R3110:Anpep UTSW 7 79,491,720 (GRCm39) missense probably benign 0.15
R3112:Anpep UTSW 7 79,491,720 (GRCm39) missense probably benign 0.15
R3898:Anpep UTSW 7 79,488,973 (GRCm39) missense probably benign 0.07
R3899:Anpep UTSW 7 79,488,973 (GRCm39) missense probably benign 0.07
R3900:Anpep UTSW 7 79,488,973 (GRCm39) missense probably benign 0.07
R4211:Anpep UTSW 7 79,490,744 (GRCm39) nonsense probably null
R4701:Anpep UTSW 7 79,489,213 (GRCm39) missense probably benign 0.16
R4716:Anpep UTSW 7 79,476,380 (GRCm39) missense probably benign 0.00
R5020:Anpep UTSW 7 79,483,475 (GRCm39) missense probably benign
R5042:Anpep UTSW 7 79,489,217 (GRCm39) missense probably benign 0.00
R5084:Anpep UTSW 7 79,476,618 (GRCm39) critical splice donor site probably null
R5319:Anpep UTSW 7 79,491,479 (GRCm39) missense probably benign
R5593:Anpep UTSW 7 79,491,794 (GRCm39) missense probably benign 0.04
R5778:Anpep UTSW 7 79,486,139 (GRCm39) missense probably benign 0.00
R5852:Anpep UTSW 7 79,488,720 (GRCm39) nonsense probably null
R5906:Anpep UTSW 7 79,483,423 (GRCm39) missense probably benign
R6164:Anpep UTSW 7 79,491,953 (GRCm39) missense possibly damaging 0.68
R6254:Anpep UTSW 7 79,488,981 (GRCm39) missense probably damaging 1.00
R6284:Anpep UTSW 7 79,475,550 (GRCm39) missense probably damaging 1.00
R6380:Anpep UTSW 7 79,491,644 (GRCm39) missense probably benign 0.04
R6594:Anpep UTSW 7 79,491,109 (GRCm39) splice site probably null
R6746:Anpep UTSW 7 79,488,933 (GRCm39) splice site probably null
R6920:Anpep UTSW 7 79,475,097 (GRCm39) missense probably damaging 1.00
R7060:Anpep UTSW 7 79,491,542 (GRCm39) missense probably benign 0.33
R7072:Anpep UTSW 7 79,485,127 (GRCm39) missense possibly damaging 0.58
R7095:Anpep UTSW 7 79,491,950 (GRCm39) missense possibly damaging 0.87
R7102:Anpep UTSW 7 79,486,061 (GRCm39) missense probably benign 0.00
R7178:Anpep UTSW 7 79,490,736 (GRCm39) missense probably benign
R7223:Anpep UTSW 7 79,475,058 (GRCm39) missense probably damaging 1.00
R7344:Anpep UTSW 7 79,488,398 (GRCm39) missense possibly damaging 0.60
R7441:Anpep UTSW 7 79,477,392 (GRCm39) missense possibly damaging 0.93
R7479:Anpep UTSW 7 79,485,118 (GRCm39) missense probably benign 0.11
R7503:Anpep UTSW 7 79,476,385 (GRCm39) missense probably damaging 1.00
R7683:Anpep UTSW 7 79,488,946 (GRCm39) missense probably damaging 0.98
R7912:Anpep UTSW 7 79,488,174 (GRCm39) missense probably benign 0.00
R7935:Anpep UTSW 7 79,476,709 (GRCm39) missense possibly damaging 0.46
R8036:Anpep UTSW 7 79,491,646 (GRCm39) missense probably benign 0.11
R8039:Anpep UTSW 7 79,489,148 (GRCm39) critical splice donor site probably null
R8470:Anpep UTSW 7 79,489,269 (GRCm39) missense probably benign 0.16
R8549:Anpep UTSW 7 79,490,644 (GRCm39) missense probably benign 0.00
R8723:Anpep UTSW 7 79,488,686 (GRCm39) missense probably damaging 1.00
R8726:Anpep UTSW 7 79,490,641 (GRCm39) missense probably benign 0.00
R9042:Anpep UTSW 7 79,488,510 (GRCm39) missense probably damaging 0.99
R9151:Anpep UTSW 7 79,491,785 (GRCm39) missense probably benign 0.31
R9200:Anpep UTSW 7 79,490,870 (GRCm39) missense probably benign 0.00
R9216:Anpep UTSW 7 79,486,049 (GRCm39) missense possibly damaging 0.49
R9570:Anpep UTSW 7 79,476,661 (GRCm39) missense probably benign 0.00
R9769:Anpep UTSW 7 79,488,478 (GRCm39) missense probably damaging 1.00
Z1176:Anpep UTSW 7 79,477,387 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCTATGAGCAGAGGTTTTACCCAC -3'
(R):5'- GATGCTGTCCAGTTTCCTGACAGAG -3'

Sequencing Primer
(F):5'- ATTACTGAGCACAGCAGCTG -3'
(R):5'- AGTTTCCTGACAGAGGACCTG -3'
Posted On 2014-01-29