Incidental Mutation 'R1274:Vmn1r234'
ID150850
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission 039340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1274 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTT to CTTT at 21229251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably null
Transcript: ENSMUST00000079633
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 T C 19: 56,914,563 D728G probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Ceacam3 A G 7: 17,163,139 R677G probably damaging Het
Col16a1 T A 4: 130,097,801 M1431K probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm11487 T C 4: 73,403,076 Y148C probably damaging Het
Gm6563 A T 19: 23,676,337 I164F probably benign Het
Nav2 C A 7: 49,604,430 Y2325* probably null Het
Olfr1163 A C 2: 88,070,595 C262W probably damaging Het
Olfr1335 T C 4: 118,809,396 N156S probably benign Het
P2ry12 T C 3: 59,217,220 T345A possibly damaging Het
Ptpn13 C T 5: 103,550,260 P1078S probably damaging Het
Rgs20 G A 1: 4,912,447 T166I probably damaging Het
Sik1 A T 17: 31,846,575 L683Q possibly damaging Het
Slc7a5 C T 8: 121,883,714 V454M probably benign Het
Snx30 A G 4: 59,885,133 T258A probably benign Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7482:Vmn1r234 UTSW 17 21229375 missense probably benign 0.07
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
R8295:Vmn1r234 UTSW 17 21228839 missense probably benign 0.01
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGTTCCACAAGCAATGGCAGC -3'
(R):5'- CTGTGCCTGTGCAAAATGAGAACC -3'

Sequencing Primer
(F):5'- CACAAGCAATGGCAGCTTTTG -3'
(R):5'- ACATTGCACAATTTTGCAGACA -3'
Posted On2014-01-29