Incidental Mutation 'R1275:Ehmt1'
Institutional Source Beutler Lab
Gene Symbol Ehmt1
Ensembl Gene ENSMUSG00000036893
Gene Nameeuchromatic histone methyltransferase 1
SynonymsKMT1D, 9230102N17Rik
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosomal Location24789928-24919614 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 24886995 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046227] [ENSMUST00000091348] [ENSMUST00000102938] [ENSMUST00000114418] [ENSMUST00000114432] [ENSMUST00000147147] [ENSMUST00000150379] [ENSMUST00000152161] [ENSMUST00000198923] [ENSMUST00000200655]
Predicted Effect probably benign
Transcript: ENSMUST00000046227
SMART Domains Protein: ENSMUSP00000046077
Gene: ENSMUSG00000036893

low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091348
SMART Domains Protein: ENSMUSP00000088906
Gene: ENSMUSG00000036893

low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 763 792 2.02e-5 SMART
ANK 796 827 3.06e-5 SMART
ANK 829 859 1.69e-7 SMART
ANK 863 892 6.65e-6 SMART
ANK 896 925 7.71e-2 SMART
ANK 929 958 6.12e-5 SMART
ANK 962 995 7.29e2 SMART
PreSET 1002 1101 1.05e-30 SMART
SET 1117 1240 2.24e-43 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102938
SMART Domains Protein: ENSMUSP00000100002
Gene: ENSMUSG00000036893

low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 770 799 2.02e-5 SMART
ANK 803 834 3.06e-5 SMART
ANK 836 866 1.69e-7 SMART
ANK 870 899 6.65e-6 SMART
ANK 903 932 7.71e-2 SMART
ANK 936 965 6.12e-5 SMART
ANK 969 1002 7.29e2 SMART
PreSET 1009 1108 1.05e-30 SMART
SET 1124 1247 2.24e-43 SMART
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114418
SMART Domains Protein: ENSMUSP00000110061
Gene: ENSMUSG00000036893

low complexity region 340 359 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
ANK 722 751 2.02e-5 SMART
ANK 755 786 3.06e-5 SMART
ANK 788 818 1.69e-7 SMART
ANK 822 851 6.65e-6 SMART
ANK 855 884 7.71e-2 SMART
ANK 888 917 6.12e-5 SMART
ANK 921 954 7.29e2 SMART
PreSET 961 1060 1.05e-30 SMART
SET 1076 1199 2.24e-43 SMART
low complexity region 1216 1229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114432
SMART Domains Protein: ENSMUSP00000110075
Gene: ENSMUSG00000036893

low complexity region 333 352 N/A INTRINSIC
low complexity region 391 412 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
ANK 717 746 2.02e-5 SMART
ANK 750 781 3.06e-5 SMART
ANK 783 813 1.69e-7 SMART
ANK 817 846 6.65e-6 SMART
ANK 850 879 7.71e-2 SMART
ANK 883 912 6.12e-5 SMART
ANK 916 949 7.29e2 SMART
PreSET 956 1055 1.05e-30 SMART
SET 1071 1194 2.24e-43 SMART
low complexity region 1211 1224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139000
Predicted Effect probably benign
Transcript: ENSMUST00000147147
SMART Domains Protein: ENSMUSP00000119057
Gene: ENSMUSG00000036893

low complexity region 252 271 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
low complexity region 352 364 N/A INTRINSIC
ANK 634 663 2.02e-5 SMART
ANK 667 698 3.06e-5 SMART
ANK 700 730 1.69e-7 SMART
ANK 734 763 6.65e-6 SMART
ANK 767 796 7.71e-2 SMART
ANK 800 829 6.12e-5 SMART
ANK 833 866 7.29e2 SMART
PreSET 873 972 1.05e-30 SMART
SET 988 1111 2.24e-43 SMART
low complexity region 1128 1141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150379
Predicted Effect probably benign
Transcript: ENSMUST00000152161
SMART Domains Protein: ENSMUSP00000119854
Gene: ENSMUSG00000036893

low complexity region 339 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192134
Predicted Effect probably benign
Transcript: ENSMUST00000198923
SMART Domains Protein: ENSMUSP00000143189
Gene: ENSMUSG00000036893

low complexity region 208 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200655
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that is part of the E2F6 complex, which represses transcription. The encoded protein methylates the Lys-9 position of histone H3, which tags it for transcriptional repression. This protein may be involved in the silencing of MYC- and E2F-responsive genes and therefore could play a role in the G0/G1 cell cycle transition. Defects in this gene are a cause of chromosome 9q subtelomeric deletion syndrome (9q-syndrome, also known as Kleefstra syndrome). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Nullizygous embryos die circa E9.5 showing delayed growth and incomplete somite formation and neural groove closure. Heterozygotes show behavioral deficits and synaptic dysfunction. Homozygotes with a H3K9me1-binding mutant form show delayed prenatal growth and bone ossification and postnatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Ehmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ehmt1 APN 2 24838818 missense possibly damaging 0.81
IGL01403:Ehmt1 APN 2 24839626 missense possibly damaging 0.81
IGL01636:Ehmt1 APN 2 24839608 missense probably damaging 0.97
IGL01804:Ehmt1 APN 2 24791954 missense probably damaging 1.00
IGL01836:Ehmt1 APN 2 24863220 splice site probably null
IGL02740:Ehmt1 APN 2 24815839 splice site probably benign
IGL02750:Ehmt1 APN 2 24863869 missense probably damaging 1.00
IGL03026:Ehmt1 APN 2 24852734 missense probably benign
IGL02799:Ehmt1 UTSW 2 24815806 missense probably damaging 1.00
R0908:Ehmt1 UTSW 2 24804888 missense probably damaging 1.00
R1665:Ehmt1 UTSW 2 24877464 missense probably damaging 1.00
R1707:Ehmt1 UTSW 2 24805138 missense probably benign
R1800:Ehmt1 UTSW 2 24884290 missense probably damaging 0.99
R2108:Ehmt1 UTSW 2 24837618 missense probably damaging 1.00
R2113:Ehmt1 UTSW 2 24804003 missense probably damaging 1.00
R2393:Ehmt1 UTSW 2 24806217 missense probably damaging 1.00
R2570:Ehmt1 UTSW 2 24815741 missense probably damaging 1.00
R3923:Ehmt1 UTSW 2 24884335 splice site probably null
R4646:Ehmt1 UTSW 2 24891684 missense probably null 0.01
R4924:Ehmt1 UTSW 2 24839722 missense probably damaging 0.97
R4989:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5040:Ehmt1 UTSW 2 24884304 missense probably benign 0.19
R5110:Ehmt1 UTSW 2 24852790 missense probably benign 0.01
R5133:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5134:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5161:Ehmt1 UTSW 2 24858195 missense possibly damaging 0.71
R5162:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5183:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5184:Ehmt1 UTSW 2 24877497 missense probably damaging 1.00
R5208:Ehmt1 UTSW 2 24801533 missense probably benign 0.34
R5309:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5312:Ehmt1 UTSW 2 24884195 missense probably damaging 1.00
R5837:Ehmt1 UTSW 2 24863914 missense probably damaging 0.98
R5968:Ehmt1 UTSW 2 24836457 missense probably damaging 0.99
R6539:Ehmt1 UTSW 2 24804767 missense probably damaging 1.00
R6646:Ehmt1 UTSW 2 24806310 missense probably damaging 0.99
R7065:Ehmt1 UTSW 2 24840697 missense probably damaging 1.00
R7226:Ehmt1 UTSW 2 24804782 missense probably damaging 1.00
R7361:Ehmt1 UTSW 2 24856701 missense possibly damaging 0.94
R7373:Ehmt1 UTSW 2 24919573 start codon destroyed probably null 0.03
R7410:Ehmt1 UTSW 2 24848068 missense probably benign
R7418:Ehmt1 UTSW 2 24884634 missense probably benign 0.02
R7633:Ehmt1 UTSW 2 24815780 missense possibly damaging 0.68
R7716:Ehmt1 UTSW 2 24884499 missense probably damaging 0.99
R7916:Ehmt1 UTSW 2 24856696 missense probably damaging 1.00
R8112:Ehmt1 UTSW 2 24863384 missense probably damaging 1.00
X0062:Ehmt1 UTSW 2 24863836 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-29