Incidental Mutation 'R1275:Efcab14'
ID150859
Institutional Source Beutler Lab
Gene Symbol Efcab14
Ensembl Gene ENSMUSG00000034210
Gene NameEF-hand calcium binding domain 14
Synonyms
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location115737744-115777327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 115756473 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 206 (L206R)
Ref Sequence ENSEMBL: ENSMUSP00000102135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074425] [ENSMUST00000106522] [ENSMUST00000106524] [ENSMUST00000106525]
Predicted Effect probably damaging
Transcript: ENSMUST00000074425
AA Change: L206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074025
Gene: ENSMUSG00000034210
AA Change: L206R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1fi6a_ 425 498 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106522
AA Change: L206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102132
Gene: ENSMUSG00000034210
AA Change: L206R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106524
AA Change: L206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102134
Gene: ENSMUSG00000034210
AA Change: L206R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 360 418 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106525
AA Change: L206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102135
Gene: ENSMUSG00000034210
AA Change: L206R

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 424 482 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136593
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Efcab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Efcab14 APN 4 115760064 splice site probably benign
IGL02300:Efcab14 APN 4 115758896 critical splice donor site probably null
IGL02598:Efcab14 APN 4 115740434 nonsense probably null
IGL02680:Efcab14 APN 4 115740418 missense probably damaging 1.00
IGL03066:Efcab14 APN 4 115738804 missense probably benign 0.12
R0123:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R0134:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R1481:Efcab14 UTSW 4 115756517 missense probably benign 0.07
R1590:Efcab14 UTSW 4 115756549 splice site probably benign
R1694:Efcab14 UTSW 4 115746539 missense possibly damaging 0.82
R1768:Efcab14 UTSW 4 115752919 critical splice acceptor site probably null
R1769:Efcab14 UTSW 4 115752991 missense probably damaging 1.00
R3887:Efcab14 UTSW 4 115738660 start codon destroyed probably null 1.00
R4158:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R4160:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R5584:Efcab14 UTSW 4 115764597 missense possibly damaging 0.49
R5690:Efcab14 UTSW 4 115760047 missense possibly damaging 0.71
R5796:Efcab14 UTSW 4 115746583 missense probably damaging 0.99
R5945:Efcab14 UTSW 4 115756467 missense probably damaging 1.00
R6445:Efcab14 UTSW 4 115756471 missense possibly damaging 0.74
R6761:Efcab14 UTSW 4 115738827 missense probably damaging 1.00
R7564:Efcab14 UTSW 4 115759962 missense probably benign 0.33
R8030:Efcab14 UTSW 4 115766402 missense probably benign 0.07
X0018:Efcab14 UTSW 4 115766486 missense probably damaging 0.99
Z1177:Efcab14 UTSW 4 115738702 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-29