Incidental Mutation 'R1275:Fosl2'
ID150860
Institutional Source Beutler Lab
Gene Symbol Fosl2
Ensembl Gene ENSMUSG00000029135
Gene Namefos-like antigen 2
SynonymsFra-2
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1275 (G1)
Quality Score152
Status Not validated
Chromosome5
Chromosomal Location32135801-32157842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32150454 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 130 (R130W)
Ref Sequence ENSEMBL: ENSMUSP00000031017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031017]
Predicted Effect probably damaging
Transcript: ENSMUST00000031017
AA Change: R130W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031017
Gene: ENSMUSG00000029135
AA Change: R130W

DomainStartEndE-ValueType
BRLZ 122 186 9.34e-15 SMART
low complexity region 224 234 N/A INTRINSIC
low complexity region 291 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202169
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one week after birth and show postnatal growth retardation. Further analysis of one allele showed abnormal cartilage development, with delayed bone ossification and impaired chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Fosl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02258:Fosl2 APN 5 32146915 missense probably damaging 1.00
R1438:Fosl2 UTSW 5 32146985 missense probably damaging 1.00
R5982:Fosl2 UTSW 5 32146873 missense probably benign 0.02
R6882:Fosl2 UTSW 5 32152864 missense possibly damaging 0.93
R7423:Fosl2 UTSW 5 32150463 missense probably damaging 1.00
R8145:Fosl2 UTSW 5 32153068 missense probably damaging 1.00
Z1177:Fosl2 UTSW 5 32152933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGAGAGACAAATGCTGCCC -3'
(R):5'- TGACGTGAGAAAATGTACTGACCCG -3'

Sequencing Primer
(F):5'- GACAAATGCTGCCCTGATG -3'
(R):5'- TCACACTCGTGGCAAAGG -3'
Posted On2014-01-29