Incidental Mutation 'R1275:1700123L14Rik'
ID150863
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene NameRIKEN cDNA 1700123L14 gene
Synonyms
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R1275 (G1)
Quality Score98
Status Not validated
Chromosome6
Chromosomal Location96164497-96166243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96165118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 315 (E315G)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090061
AA Change: E315G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: E315G

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
PIT4283001:1700123L14Rik UTSW 6 96165715 missense probably benign
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R0946:1700123L14Rik UTSW 6 96165696 missense possibly damaging 0.68
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R3708:1700123L14Rik UTSW 6 96165952 missense possibly damaging 0.92
R4157:1700123L14Rik UTSW 6 96165283 missense possibly damaging 0.86
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6792:1700123L14Rik UTSW 6 96165115 missense possibly damaging 0.92
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
R7081:1700123L14Rik UTSW 6 96165817 missense possibly damaging 0.68
R7194:1700123L14Rik UTSW 6 96164775 missense probably benign 0.04
R7584:1700123L14Rik UTSW 6 96165392 missense probably benign 0.41
R7938:1700123L14Rik UTSW 6 96164885 missense possibly damaging 0.66
R7983:1700123L14Rik UTSW 6 96165907 missense probably damaging 0.96
R8052:1700123L14Rik UTSW 6 96165097 intron probably benign
R8052:1700123L14Rik UTSW 6 96165103 intron probably benign
R8303:1700123L14Rik UTSW 6 96165721 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCTGCCTAACTTAGTATCCCGCAC -3'
(R):5'- AGGAGCAACGAGTACCTCCTGTAAC -3'

Sequencing Primer
(F):5'- TAGTATCCCGCACTAAGAGCTTC -3'
(R):5'- AACGAGTACCTCCTGTAACTTTGG -3'
Posted On2014-01-29