Incidental Mutation 'R1275:Coro1a'
ID150864
Institutional Source Beutler Lab
Gene Symbol Coro1a
Ensembl Gene ENSMUSG00000030707
Gene Namecoronin, actin binding protein 1A
SynonymsClabp, Lmb3, coronin 1, p57
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126699773-126707787 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 126700583 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032949] [ENSMUST00000106364] [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000131415] [ENSMUST00000135087] [ENSMUST00000173108] [ENSMUST00000173108] [ENSMUST00000205515] [ENSMUST00000142337] [ENSMUST00000144897] [ENSMUST00000173116]
Predicted Effect probably null
Transcript: ENSMUST00000032949
SMART Domains Protein: ENSMUSP00000032949
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
PDB:2AKF|C 430 461 3e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably null
Transcript: ENSMUST00000106364
SMART Domains Protein: ENSMUSP00000101972
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
Pfam:Trimer_CC 410 461 4.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126193
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131415
SMART Domains Protein: ENSMUSP00000117931
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133718
Predicted Effect probably benign
Transcript: ENSMUST00000135087
SMART Domains Protein: ENSMUSP00000115960
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173108
SMART Domains Protein: ENSMUSP00000134123
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 365 3.06e-53 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173108
SMART Domains Protein: ENSMUSP00000134123
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 365 3.06e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Predicted Effect probably benign
Transcript: ENSMUST00000205515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144897
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173116
SMART Domains Protein: ENSMUSP00000133555
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the WD repeat coronin family. The encoded protein may bind actin and interact with microtubules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for null or hypomorph alleles of this gene display lower peripheral T cell counts resulting from defects in T cell migration and increased rates of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Coro1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Coro1a APN 7 126701529 missense probably benign 0.00
IGL02307:Coro1a APN 7 126701564 missense probably damaging 1.00
IGL02380:Coro1a APN 7 126703116 nonsense probably null
coralina UTSW 7 126703049 missense probably damaging 1.00
holiday UTSW 7 126700644 splice site probably null
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0394:Coro1a UTSW 7 126700640 missense probably benign 0.01
R1552:Coro1a UTSW 7 126699952 missense probably benign 0.13
R1598:Coro1a UTSW 7 126701692 missense possibly damaging 0.71
R1618:Coro1a UTSW 7 126701547 missense probably benign 0.05
R2116:Coro1a UTSW 7 126702022 missense probably damaging 1.00
R4591:Coro1a UTSW 7 126702992 missense probably damaging 1.00
R5159:Coro1a UTSW 7 126703049 missense probably damaging 1.00
R5261:Coro1a UTSW 7 126700644 splice site probably null
R6002:Coro1a UTSW 7 126703080 missense probably benign 0.00
R7237:Coro1a UTSW 7 126700306 missense probably benign
R7560:Coro1a UTSW 7 126703134 missense probably damaging 0.99
R7956:Coro1a UTSW 7 126701555 missense probably benign 0.30
RF007:Coro1a UTSW 7 126701852 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTCCCCATGAGACATTGAGCAC -3'
(R):5'- GCCAGGTGACTGACTCCTAATTGAC -3'

Sequencing Primer
(F):5'- TTGAGCACATCCATGCAGG -3'
(R):5'- GTGACTGACTCCTAATTGACTGACC -3'
Posted On2014-01-29