Incidental Mutation 'R1275:Rassf7'
ID150865
Institutional Source Beutler Lab
Gene Symbol Rassf7
Ensembl Gene ENSMUSG00000038618
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1275 (G1)
Quality Score184
Status Not validated
Chromosome7
Chromosomal Location141215860-141218658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141217147 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 91 (L91Q)
Ref Sequence ENSEMBL: ENSMUSP00000147482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000153081] [ENSMUST00000170841] [ENSMUST00000209500] [ENSMUST00000210993]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000046890
AA Change: L91Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618
AA Change: L91Q

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083617
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably damaging
Transcript: ENSMUST00000133763
AA Change: L91Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618
AA Change: L91Q

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141804
AA Change: L91Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618
AA Change: L91Q

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149548
Predicted Effect probably damaging
Transcript: ENSMUST00000153081
AA Change: L91Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618
AA Change: L91Q

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209500
AA Change: L91Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210993
AA Change: L91Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209760
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Rassf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Rassf7 APN 7 141218290 missense possibly damaging 0.95
R0883:Rassf7 UTSW 7 141216990 splice site probably benign
R1616:Rassf7 UTSW 7 141216732 missense probably damaging 1.00
R5546:Rassf7 UTSW 7 141217060 splice site probably null
R5597:Rassf7 UTSW 7 141217111 missense probably damaging 1.00
R5663:Rassf7 UTSW 7 141217090 missense probably damaging 1.00
R6250:Rassf7 UTSW 7 141217243 missense probably damaging 0.98
R6806:Rassf7 UTSW 7 141216809 missense probably damaging 1.00
R6817:Rassf7 UTSW 7 141217447 missense probably damaging 1.00
R6962:Rassf7 UTSW 7 141217590 missense possibly damaging 0.86
R7054:Rassf7 UTSW 7 141217643 missense probably benign 0.01
R7562:Rassf7 UTSW 7 141217188 nonsense probably null
R7682:Rassf7 UTSW 7 141217934 missense probably damaging 1.00
X0026:Rassf7 UTSW 7 141218132 nonsense probably null
Z1088:Rassf7 UTSW 7 141217145 missense probably damaging 1.00
Z1177:Rassf7 UTSW 7 141218285 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTGTGGTCTAACAGCATCTTCCC -3'
(R):5'- AGGTCTGCAAAGCCGTCTGGTATG -3'

Sequencing Primer
(F):5'- GATTGCTCTATTCTTCAAGCCAG -3'
(R):5'- CCGTCTGGTATGGGTCCTAC -3'
Posted On2014-01-29