Incidental Mutation 'R1275:Zfp930'
ID150866
Institutional Source Beutler Lab
Gene Symbol Zfp930
Ensembl Gene ENSMUSG00000059897
Gene Namezinc finger protein 930
SynonymsD10627, zinc finger protein
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69209038-69230536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69227979 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 108 (K108E)
Ref Sequence ENSEMBL: ENSMUSP00000105845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110216] [ENSMUST00000212312] [ENSMUST00000212681]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110216
AA Change: K108E

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105845
Gene: ENSMUSG00000059897
AA Change: K108E

DomainStartEndE-ValueType
KRAB 3 62 1.39e-13 SMART
ZnF_C2H2 73 95 1.07e0 SMART
ZnF_C2H2 101 123 6.88e-4 SMART
ZnF_C2H2 129 151 1.98e-4 SMART
ZnF_C2H2 157 179 2.63e0 SMART
ZnF_C2H2 185 207 1.3e-4 SMART
ZnF_C2H2 213 235 1.22e-4 SMART
ZnF_C2H2 241 263 7.49e-5 SMART
ZnF_C2H2 269 291 1.13e-4 SMART
ZnF_C2H2 297 319 1.84e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.22e-4 SMART
ZnF_C2H2 381 403 5.29e-5 SMART
ZnF_C2H2 409 431 1.72e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212090
Predicted Effect silent
Transcript: ENSMUST00000212312
Predicted Effect possibly damaging
Transcript: ENSMUST00000212681
AA Change: K109E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Other mutations in Zfp930
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp930 APN 8 69227982 missense probably damaging 1.00
Bodyguard UTSW 8 69228685 missense probably damaging 1.00
R0389:Zfp930 UTSW 8 69228296 nonsense probably null
R1322:Zfp930 UTSW 8 69228168 missense probably benign 0.02
R1802:Zfp930 UTSW 8 69226394 missense possibly damaging 0.50
R1917:Zfp930 UTSW 8 69228705 missense probably benign 0.02
R1918:Zfp930 UTSW 8 69228705 missense probably benign 0.02
R1981:Zfp930 UTSW 8 69228172 missense probably damaging 1.00
R4492:Zfp930 UTSW 8 69228246 nonsense probably null
R4530:Zfp930 UTSW 8 69228831 nonsense probably null
R4769:Zfp930 UTSW 8 69226692 missense probably benign 0.09
R4906:Zfp930 UTSW 8 69228945 missense probably benign 0.11
R5314:Zfp930 UTSW 8 69226721 missense probably benign 0.27
R5708:Zfp930 UTSW 8 69226461 missense probably benign 0.08
R6004:Zfp930 UTSW 8 69227904 missense probably benign
R6385:Zfp930 UTSW 8 69228631 missense probably damaging 1.00
R7095:Zfp930 UTSW 8 69228541 missense probably benign
R7619:Zfp930 UTSW 8 69209158 start codon destroyed probably null 0.95
R7641:Zfp930 UTSW 8 69228685 missense probably damaging 1.00
R7674:Zfp930 UTSW 8 69228685 missense probably damaging 1.00
R8300:Zfp930 UTSW 8 69228346 missense probably benign 0.00
Predicted Primers
Posted On2014-01-29