Incidental Mutation 'R1275:Clstn2'
Institutional Source Beutler Lab
Gene Symbol Clstn2
Ensembl Gene ENSMUSG00000032452
Gene Namecalsyntenin 2
SynonymsCst-2, CSTN2, CS2, 2900042C18Rik
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosomal Location97444395-98033181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97457430 bp
Amino Acid Change Valine to Isoleucine at position 793 (V793I)
Ref Sequence ENSEMBL: ENSMUSP00000124081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]
Predicted Effect probably benign
Transcript: ENSMUST00000035027
AA Change: V793I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: V793I

signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
SCOP:d1a8d_1 358 538 5e-21 SMART
Blast:LamG 380 529 3e-41 BLAST
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162295
AA Change: V793I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: V793I

signal peptide 1 22 N/A INTRINSIC
CA 67 160 2e-10 SMART
CA 183 261 1.18e-3 SMART
Pfam:Laminin_G_3 356 533 1.4e-9 PFAM
transmembrane domain 835 857 N/A INTRINSIC
low complexity region 901 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Clstn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Clstn2 APN 9 97582452 splice site probably benign
IGL00563:Clstn2 APN 9 97582452 splice site probably benign
IGL00733:Clstn2 APN 9 97483049 missense probably damaging 1.00
IGL01303:Clstn2 APN 9 97483075 nonsense probably null
IGL01935:Clstn2 APN 9 97463468 missense probably damaging 1.00
IGL02157:Clstn2 APN 9 97541875 missense probably benign
IGL02974:Clstn2 APN 9 97532707 missense probably damaging 1.00
IGL03164:Clstn2 APN 9 97799409 missense possibly damaging 0.50
IGL03298:Clstn2 APN 9 97456572 missense probably damaging 1.00
R0653:Clstn2 UTSW 9 97458204 missense probably damaging 1.00
R0845:Clstn2 UTSW 9 97570628 missense probably benign 0.39
R0992:Clstn2 UTSW 9 97445712 missense probably benign 0.00
R1105:Clstn2 UTSW 9 97583499 splice site probably null
R1112:Clstn2 UTSW 9 97458228 missense possibly damaging 0.92
R1264:Clstn2 UTSW 9 97457609 missense probably benign 0.28
R1329:Clstn2 UTSW 9 97458174 missense probably damaging 1.00
R1396:Clstn2 UTSW 9 97461393 missense probably benign 0.02
R1556:Clstn2 UTSW 9 97456505 missense probably benign 0.41
R1703:Clstn2 UTSW 9 97458237 missense possibly damaging 0.90
R1837:Clstn2 UTSW 9 97583540 missense probably benign 0.00
R2911:Clstn2 UTSW 9 97532722 missense probably damaging 1.00
R3434:Clstn2 UTSW 9 97454715 missense probably benign 0.17
R3771:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3772:Clstn2 UTSW 9 97582562 missense probably damaging 1.00
R3854:Clstn2 UTSW 9 97463595 nonsense probably null
R4049:Clstn2 UTSW 9 97457560 missense possibly damaging 0.59
R4334:Clstn2 UTSW 9 97463528 missense probably damaging 1.00
R4705:Clstn2 UTSW 9 97463559 missense possibly damaging 0.95
R4755:Clstn2 UTSW 9 97445673 missense probably benign 0.01
R4884:Clstn2 UTSW 9 97799395 missense probably damaging 1.00
R5017:Clstn2 UTSW 9 97483086 missense probably damaging 1.00
R5076:Clstn2 UTSW 9 97483079 missense probably damaging 1.00
R5122:Clstn2 UTSW 9 97461421 missense probably damaging 1.00
R5155:Clstn2 UTSW 9 97456431 missense probably benign 0.02
R5560:Clstn2 UTSW 9 97469819 missense possibly damaging 0.95
R6009:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6011:Clstn2 UTSW 9 97456526 missense probably benign 0.05
R6029:Clstn2 UTSW 9 97456581 missense probably benign 0.00
R6093:Clstn2 UTSW 9 97458210 missense probably damaging 1.00
R6284:Clstn2 UTSW 9 97454674 missense probably benign
R6676:Clstn2 UTSW 9 97461531 missense probably damaging 1.00
R6902:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6946:Clstn2 UTSW 9 97469822 missense probably damaging 1.00
R6966:Clstn2 UTSW 9 97526406 nonsense probably null
R7329:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7330:Clstn2 UTSW 9 97461369 missense probably benign 0.00
R7382:Clstn2 UTSW 9 97799398 nonsense probably null
R7410:Clstn2 UTSW 9 97541867 missense probably benign 0.06
R7549:Clstn2 UTSW 9 97582544 missense probably benign 0.01
R7879:Clstn2 UTSW 9 97469764 missense possibly damaging 0.90
R8070:Clstn2 UTSW 9 97799470 missense possibly damaging 0.79
R8193:Clstn2 UTSW 9 97583630 missense probably damaging 1.00
R8422:Clstn2 UTSW 9 97458186 missense probably benign 0.39
X0027:Clstn2 UTSW 9 97526399 missense probably damaging 1.00
Z1177:Clstn2 UTSW 9 97461356 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-01-29