Mutagenetix > Incidental Mutations

Incidental Mutation 'R1275:Clstn2'

150869

Institutional Source

Beutler Lab

Gene Symbol

Clstn2

Ensembl Gene

ENSMUSG00000032452

Gene Name

calsyntenin 2

Synonyms

Cst-2, CSTN2, CS2, 2900042C18Rik

MMRRC Submission

039341-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1275 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97444395-98033181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97457430 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 793 (V793I)

Ref Sequence

ENSEMBL: ENSMUSP00000124081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035027] [ENSMUST00000162295]

Predicted Effect

probably benign
Transcript: ENSMUST00000035027
AA Change: V793I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000035027
Gene: ENSMUSG00000032452
AA Change: V793I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
SCOP:d1a8d_1	358	538	5e-21	SMART
Blast:LamG	380	529	3e-41	BLAST
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162295
AA Change: V793I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000124081
Gene: ENSMUSG00000032452
AA Change: V793I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CA	67	160	2e-10	SMART
CA	183	261	1.18e-3	SMART
Pfam:Laminin_G_3	356	533	1.4e-9	PFAM
transmembrane domain	835	857	N/A	INTRINSIC
low complexity region	901	935	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous KO mice display deficiency in spatial learning and memory in Morris water and Barnes maze tasks and increased locomotor activity in open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110034G24Rik	T	C	2: 132,692,095	S48P	probably benign	Het
1700123L14Rik	T	C	6: 96,165,118	E315G	probably benign	Het
Coro1a	C	T	7: 126,700,583		probably null	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Efcab14	T	G	4: 115,756,473	L206R	probably damaging	Het
Ehmt1	A	G	2: 24,886,995		probably null	Het
Fosl2	C	T	5: 32,150,454	R130W	probably damaging	Het
Gfral	A	G	9: 76,197,032	C233R	probably damaging	Het
Gm281	T	C	14: 13,896,949	Y142C	probably damaging	Het
Ino80	T	C	2: 119,427,055	T765A	probably benign	Het
Mindy3	A	T	2: 12,396,173		probably null	Het
Myo15b	CGGAGGAGGAGGAGGAGGAG	CGGAGGAGGAGGAGGAG	11: 115,883,492		probably benign	Het
Osbpl11	T	A	16: 33,185,850	M16K	probably benign	Het
Rassf7	T	A	7: 141,217,147	L91Q	probably damaging	Het
Unc13b	A	G	4: 43,235,366	K3318R	probably damaging	Het
Vmn1r234	CTT	CTTT	17: 21,229,251		probably null	Het
Zfp930	A	G	8: 69,227,979	K108E	possibly damaging	Het

Other mutations in Clstn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Clstn2	APN	9	97582452	splice site	probably benign
IGL00563:Clstn2	APN	9	97582452	splice site	probably benign
IGL00733:Clstn2	APN	9	97483049	missense	probably damaging	1.00
IGL01303:Clstn2	APN	9	97483075	nonsense	probably null
IGL01935:Clstn2	APN	9	97463468	missense	probably damaging	1.00
IGL02157:Clstn2	APN	9	97541875	missense	probably benign
IGL02974:Clstn2	APN	9	97532707	missense	probably damaging	1.00
IGL03164:Clstn2	APN	9	97799409	missense	possibly damaging	0.50
IGL03298:Clstn2	APN	9	97456572	missense	probably damaging	1.00
R0653:Clstn2	UTSW	9	97458204	missense	probably damaging	1.00
R0845:Clstn2	UTSW	9	97570628	missense	probably benign	0.39
R0992:Clstn2	UTSW	9	97445712	missense	probably benign	0.00
R1105:Clstn2	UTSW	9	97583499	splice site	probably null
R1112:Clstn2	UTSW	9	97458228	missense	possibly damaging	0.92
R1264:Clstn2	UTSW	9	97457609	missense	probably benign	0.28
R1329:Clstn2	UTSW	9	97458174	missense	probably damaging	1.00
R1396:Clstn2	UTSW	9	97461393	missense	probably benign	0.02
R1556:Clstn2	UTSW	9	97456505	missense	probably benign	0.41
R1703:Clstn2	UTSW	9	97458237	missense	possibly damaging	0.90
R1837:Clstn2	UTSW	9	97583540	missense	probably benign	0.00
R2911:Clstn2	UTSW	9	97532722	missense	probably damaging	1.00
R3434:Clstn2	UTSW	9	97454715	missense	probably benign	0.17
R3771:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3772:Clstn2	UTSW	9	97582562	missense	probably damaging	1.00
R3854:Clstn2	UTSW	9	97463595	nonsense	probably null
R4049:Clstn2	UTSW	9	97457560	missense	possibly damaging	0.59
R4334:Clstn2	UTSW	9	97463528	missense	probably damaging	1.00
R4705:Clstn2	UTSW	9	97463559	missense	possibly damaging	0.95
R4755:Clstn2	UTSW	9	97445673	missense	probably benign	0.01
R4884:Clstn2	UTSW	9	97799395	missense	probably damaging	1.00
R5017:Clstn2	UTSW	9	97483086	missense	probably damaging	1.00
R5076:Clstn2	UTSW	9	97483079	missense	probably damaging	1.00
R5122:Clstn2	UTSW	9	97461421	missense	probably damaging	1.00
R5155:Clstn2	UTSW	9	97456431	missense	probably benign	0.02
R5560:Clstn2	UTSW	9	97469819	missense	possibly damaging	0.95
R6009:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6011:Clstn2	UTSW	9	97456526	missense	probably benign	0.05
R6029:Clstn2	UTSW	9	97456581	missense	probably benign	0.00
R6093:Clstn2	UTSW	9	97458210	missense	probably damaging	1.00
R6284:Clstn2	UTSW	9	97454674	missense	probably benign
R6676:Clstn2	UTSW	9	97461531	missense	probably damaging	1.00
R6902:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6946:Clstn2	UTSW	9	97469822	missense	probably damaging	1.00
R6966:Clstn2	UTSW	9	97526406	nonsense	probably null
R7329:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7330:Clstn2	UTSW	9	97461369	missense	probably benign	0.00
R7382:Clstn2	UTSW	9	97799398	nonsense	probably null
R7410:Clstn2	UTSW	9	97541867	missense	probably benign	0.06
R7549:Clstn2	UTSW	9	97582544	missense	probably benign	0.01
R7879:Clstn2	UTSW	9	97469764	missense	possibly damaging	0.90
R8070:Clstn2	UTSW	9	97799470	missense	possibly damaging	0.79
R8193:Clstn2	UTSW	9	97583630	missense	probably damaging	1.00
R8422:Clstn2	UTSW	9	97458186	missense	probably benign	0.39
X0027:Clstn2	UTSW	9	97526399	missense	probably damaging	1.00
Z1177:Clstn2	UTSW	9	97461356	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACGAGCATAATTTTGTCCCAGCCC -3'
(R):5'- GGATCAAGTGCTCAGAACTCAACGG -3'

Sequencing Primer
(F):5'- CTCCTTATTGGAACCAAGAATGTCC -3'
(R):5'- TCAACGGGCGTTACACTAGC -3'

Posted On

2014-01-29