Incidental Mutation 'R1275:Osbpl11'
ID150874
Institutional Source Beutler Lab
Gene Symbol Osbpl11
Ensembl Gene ENSMUSG00000022807
Gene Nameoxysterol binding protein-like 11
SynonymsORP-11
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33185071-33243312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33185850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 16 (M16K)
Ref Sequence ENSEMBL: ENSMUSP00000155873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039733] [ENSMUST00000232100] [ENSMUST00000232181]
Predicted Effect probably benign
Transcript: ENSMUST00000039733
AA Change: M16K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039632
Gene: ENSMUSG00000022807
AA Change: M16K

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
PH 70 168 2.03e-14 SMART
low complexity region 257 268 N/A INTRINSIC
Pfam:Oxysterol_BP 383 749 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232100
AA Change: M10K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000232181
AA Change: M16K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T C 2: 132,692,095 S48P probably benign Het
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in Osbpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Osbpl11 APN 16 33241745 missense probably damaging 1.00
IGL01084:Osbpl11 APN 16 33226851 splice site probably benign
IGL03009:Osbpl11 APN 16 33241730 splice site probably benign
PIT4504001:Osbpl11 UTSW 16 33234494 missense probably benign 0.04
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0071:Osbpl11 UTSW 16 33214338 splice site probably benign
R0472:Osbpl11 UTSW 16 33234444 nonsense probably null
R0508:Osbpl11 UTSW 16 33196095 missense probably benign
R0609:Osbpl11 UTSW 16 33234444 nonsense probably null
R0715:Osbpl11 UTSW 16 33241730 splice site probably benign
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1148:Osbpl11 UTSW 16 33227212 missense probably damaging 1.00
R1459:Osbpl11 UTSW 16 33236329 missense probably damaging 1.00
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1464:Osbpl11 UTSW 16 33229085 missense probably damaging 0.97
R1591:Osbpl11 UTSW 16 33209983 missense probably benign 0.00
R1752:Osbpl11 UTSW 16 33204835 missense probably damaging 1.00
R1883:Osbpl11 UTSW 16 33214353 missense probably benign
R1916:Osbpl11 UTSW 16 33185843 missense probably benign
R1916:Osbpl11 UTSW 16 33210095 missense possibly damaging 0.82
R4369:Osbpl11 UTSW 16 33224648 missense probably damaging 1.00
R4649:Osbpl11 UTSW 16 33196082 missense probably benign 0.12
R4873:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R4875:Osbpl11 UTSW 16 33234493 missense probably benign 0.00
R6074:Osbpl11 UTSW 16 33209965 missense probably benign 0.28
R6274:Osbpl11 UTSW 16 33227056 missense probably damaging 1.00
R7007:Osbpl11 UTSW 16 33226939 missense possibly damaging 0.81
R7399:Osbpl11 UTSW 16 33236279 missense probably benign
R7698:Osbpl11 UTSW 16 33234447 missense probably benign 0.04
R7814:Osbpl11 UTSW 16 33210061 nonsense probably null
R7934:Osbpl11 UTSW 16 33236382 missense probably damaging 1.00
Z1177:Osbpl11 UTSW 16 33227084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCACTGTCGATTTCCACTCTAGC -3'
(R):5'- TTGGCCTTCCAACTGGGATATGC -3'

Sequencing Primer
(F):5'- GATTTCCACTCTAGCCGAGG -3'
(R):5'- TTCCAACTGGGATATGCAGACC -3'
Posted On2014-01-29