Incidental Mutation 'R1276:Egln2'
ID150890
Institutional Source Beutler Lab
Gene Symbol Egln2
Ensembl Gene ENSMUSG00000058709
Gene Nameegl-9 family hypoxia-inducible factor 2
SynonymsSM-20, Phd1, Ier4, 0610011A13Rik, Hif-p4h-1
MMRRC Submission 039342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1276 (G1)
Quality Score132
Status Not validated
Chromosome7
Chromosomal Location27158658-27166802 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTG at 27165005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000093040] [ENSMUST00000108382] [ENSMUST00000153511] [ENSMUST00000154724]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093040
SMART Domains Protein: ENSMUSP00000090727
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
RAB 9 172 2.47e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152753
Predicted Effect probably benign
Transcript: ENSMUST00000153511
SMART Domains Protein: ENSMUSP00000138477
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
Pfam:Arf 3 97 1.8e-11 PFAM
Pfam:Miro 10 95 9.5e-15 PFAM
Pfam:Ras 10 95 7.8e-35 PFAM
Pfam:Gtr1_RagA 10 98 4.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154724
SMART Domains Protein: ENSMUSP00000122859
Gene: ENSMUSG00000095538

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SH3 46 112 8.92e-5 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes are viable with no apparent abnormalities in cardiovascular, hematopoietic, or placental morphology and development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,119,824 A660D probably damaging Het
Ccdc82 A T 9: 13,281,413 I443F probably benign Het
Cct4 C T 11: 23,002,171 L391F probably damaging Het
Cep63 A T 9: 102,588,900 D642E possibly damaging Het
Chd5 T A 4: 152,378,734 L1424Q probably damaging Het
Cox4i1 A G 8: 120,673,350 Y71C probably damaging Het
Cyp2c69 T A 19: 39,876,224 Q270L possibly damaging Het
Fbln1 A G 15: 85,229,590 D175G probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm9847 A G 12: 14,494,931 noncoding transcript Het
Hdlbp A T 1: 93,421,101 S576T probably benign Het
Hmgxb3 T C 18: 61,165,504 N296S probably benign Het
Lrba T A 3: 86,664,526 V2379E probably damaging Het
Lrp1b A T 2: 41,728,576 I162N probably benign Het
Mydgf A G 17: 56,179,362 probably null Het
Sh3pxd2a T C 19: 47,268,383 D632G probably benign Het
Ska3 T C 14: 57,820,269 M209V probably damaging Het
Slc4a10 A G 2: 62,250,443 E308G probably damaging Het
Srsf4 C T 4: 131,897,685 T131M probably damaging Het
Suco A T 1: 161,857,456 S156T probably benign Het
Svs2 T A 2: 164,237,248 Q246H possibly damaging Het
Syne2 A G 12: 75,941,189 probably null Het
Tbc1d9b T A 11: 50,152,649 H532Q possibly damaging Het
Tcf21 G A 10: 22,819,590 T105I probably damaging Het
Thsd7a C A 6: 12,418,370 C620F probably damaging Het
Vmn1r194 A G 13: 22,244,861 Y216C probably damaging Het
Vmn2r94 T C 17: 18,257,082 S356G possibly damaging Het
Wasf1 T A 10: 40,936,526 I437N unknown Het
Wdr24 A G 17: 25,827,467 Y538C probably benign Het
Zbtb4 G T 11: 69,776,219 D117Y probably damaging Het
Zfp654 A T 16: 64,785,336 F293L probably damaging Het
Zkscan7 A G 9: 122,890,723 E158G probably damaging Het
Other mutations in Egln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Egln2 APN 7 27160292 missense probably null 0.03
IGL01975:Egln2 APN 7 27160320 missense possibly damaging 0.50
IGL02261:Egln2 APN 7 27159866 missense possibly damaging 0.78
R0268:Egln2 UTSW 7 27165247 missense possibly damaging 0.57
R1455:Egln2 UTSW 7 27160371 missense probably damaging 1.00
R4569:Egln2 UTSW 7 27159583 missense probably damaging 1.00
R4656:Egln2 UTSW 7 27159193 missense probably benign 0.00
R7201:Egln2 UTSW 7 27160319 missense probably damaging 1.00
R7216:Egln2 UTSW 7 27159829 missense probably damaging 1.00
R7302:Egln2 UTSW 7 27164885 missense probably damaging 0.98
Z1177:Egln2 UTSW 7 27164990 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTTGCCCATCACGAAGACGC -3'
(R):5'- TTGGAGTCTAGCCGAGCCAGAATG -3'

Sequencing Primer
(F):5'- TCAGGGCTTCCACCTCAG -3'
(R):5'- TTGGTCACCAAGGAGTGC -3'
Posted On2014-01-29