Incidental Mutation 'R1276:Cox4i1'
ID 150892
Institutional Source Beutler Lab
Gene Symbol Cox4i1
Ensembl Gene ENSMUSG00000031818
Gene Name cytochrome c oxidase subunit 4I1
Synonyms COXIV, Cox4a, Cox4
MMRRC Submission 039342-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1276 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 121394964-121400948 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121400089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 71 (Y71C)
Ref Sequence ENSEMBL: ENSMUSP00000138063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034276] [ENSMUST00000127664] [ENSMUST00000180417] [ENSMUST00000181795] [ENSMUST00000181586] [ENSMUST00000181847]
AlphaFold P19783
Predicted Effect probably damaging
Transcript: ENSMUST00000034276
AA Change: Y124C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034276
Gene: ENSMUSG00000031818
AA Change: Y124C

DomainStartEndE-ValueType
Pfam:COX4 28 168 2.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180417
SMART Domains Protein: ENSMUSP00000137767
Gene: ENSMUSG00000031819

DomainStartEndE-ValueType
Pfam:UPF0172 1 103 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181172
Predicted Effect probably damaging
Transcript: ENSMUST00000181795
AA Change: Y71C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138063
Gene: ENSMUSG00000031818
AA Change: Y71C

DomainStartEndE-ValueType
Pfam:COX4 2 92 4.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000181586
AA Change: Y124C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138019
Gene: ENSMUSG00000031818
AA Change: Y124C

DomainStartEndE-ValueType
Pfam:COX4 26 168 3.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181847
SMART Domains Protein: ENSMUSP00000138053
Gene: ENSMUSG00000031818

DomainStartEndE-ValueType
PDB:2Y69|Q 1 35 4e-7 PDB
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit IV isoform 1 of the human mitochondrial respiratory chain enzyme. It is located at the 3' of the NOC4 (neighbor of COX4) gene in a head-to-head orientation, and shares a promoter with it. Pseudogenes related to this gene are located on chromosomes 13 and 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,609,852 (GRCm39) A660D probably damaging Het
Ccdc82 A T 9: 13,281,903 (GRCm39) I443F probably benign Het
Cct4 C T 11: 22,952,171 (GRCm39) L391F probably damaging Het
Cep63 A T 9: 102,466,099 (GRCm39) D642E possibly damaging Het
Chd5 T A 4: 152,463,191 (GRCm39) L1424Q probably damaging Het
Cyp2c69 T A 19: 39,864,668 (GRCm39) Q270L possibly damaging Het
Egln2 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 7: 26,864,430 (GRCm39) probably benign Het
Fbln1 A G 15: 85,113,791 (GRCm39) D175G probably damaging Het
Fbxw15 G A 9: 109,387,314 (GRCm39) S227F probably damaging Het
Gm9847 A G 12: 14,544,932 (GRCm39) noncoding transcript Het
Hdlbp A T 1: 93,348,823 (GRCm39) S576T probably benign Het
Hmgxb3 T C 18: 61,298,576 (GRCm39) N296S probably benign Het
Lrba T A 3: 86,571,833 (GRCm39) V2379E probably damaging Het
Lrp1b A T 2: 41,618,588 (GRCm39) I162N probably benign Het
Mydgf A G 17: 56,486,362 (GRCm39) probably null Het
Sh3pxd2a T C 19: 47,256,822 (GRCm39) D632G probably benign Het
Ska3 T C 14: 58,057,726 (GRCm39) M209V probably damaging Het
Slc4a10 A G 2: 62,080,787 (GRCm39) E308G probably damaging Het
Srsf4 C T 4: 131,624,996 (GRCm39) T131M probably damaging Het
Suco A T 1: 161,685,025 (GRCm39) S156T probably benign Het
Svs5 T A 2: 164,079,168 (GRCm39) Q246H possibly damaging Het
Syne2 A G 12: 75,987,963 (GRCm39) probably null Het
Tbc1d9b T A 11: 50,043,476 (GRCm39) H532Q possibly damaging Het
Tcf21 G A 10: 22,695,489 (GRCm39) T105I probably damaging Het
Thsd7a C A 6: 12,418,369 (GRCm39) C620F probably damaging Het
Vmn1r194 A G 13: 22,429,031 (GRCm39) Y216C probably damaging Het
Vmn2r94 T C 17: 18,477,344 (GRCm39) S356G possibly damaging Het
Wasf1 T A 10: 40,812,522 (GRCm39) I437N unknown Het
Wdr24 A G 17: 26,046,441 (GRCm39) Y538C probably benign Het
Zbtb4 G T 11: 69,667,045 (GRCm39) D117Y probably damaging Het
Zfp654 A T 16: 64,605,699 (GRCm39) F293L probably damaging Het
Zkscan7 A G 9: 122,719,788 (GRCm39) E158G probably damaging Het
Other mutations in Cox4i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cox4i1 APN 8 121,399,604 (GRCm39) missense probably benign 0.15
R1174:Cox4i1 UTSW 8 121,400,789 (GRCm39) missense probably benign 0.41
R2507:Cox4i1 UTSW 8 121,400,029 (GRCm39) missense possibly damaging 0.95
R2508:Cox4i1 UTSW 8 121,400,029 (GRCm39) missense possibly damaging 0.95
R2698:Cox4i1 UTSW 8 121,396,102 (GRCm39) unclassified probably benign
R6523:Cox4i1 UTSW 8 121,399,480 (GRCm39) missense probably benign 0.13
R6747:Cox4i1 UTSW 8 121,399,969 (GRCm39) missense possibly damaging 0.95
R7429:Cox4i1 UTSW 8 121,400,770 (GRCm39) missense probably damaging 1.00
R7430:Cox4i1 UTSW 8 121,400,770 (GRCm39) missense probably damaging 1.00
R7750:Cox4i1 UTSW 8 121,400,049 (GRCm39) missense probably benign 0.01
R8086:Cox4i1 UTSW 8 121,400,779 (GRCm39) missense probably damaging 1.00
R8709:Cox4i1 UTSW 8 121,396,110 (GRCm39) missense possibly damaging 0.95
R9028:Cox4i1 UTSW 8 121,398,022 (GRCm39) unclassified probably benign
Z1177:Cox4i1 UTSW 8 121,395,019 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTGTCTCATTCAGTGTACCGC -3'
(R):5'- CTATGGAAAAGGCCGACATCCCAG -3'

Sequencing Primer
(F):5'- GCATCCAGTTTAACGAGAGCTTC -3'
(R):5'- ACTCCAGATGCTTGGGAAC -3'
Posted On 2014-01-29