Incidental Mutation 'R1276:Vmn1r194'
ID150904
Institutional Source Beutler Lab
Gene Symbol Vmn1r194
Ensembl Gene ENSMUSG00000069297
Gene Namevomeronasal 1 receptor 194
SynonymsGm11294
MMRRC Submission 039342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1276 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22244215-22245105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22244861 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 216 (Y216C)
Ref Sequence ENSEMBL: ENSMUSP00000089331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091737]
Predicted Effect probably damaging
Transcript: ENSMUST00000091737
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089331
Gene: ENSMUSG00000069297
AA Change: Y216C

DomainStartEndE-ValueType
Pfam:V1R 35 296 3.4e-37 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,119,824 A660D probably damaging Het
Ccdc82 A T 9: 13,281,413 I443F probably benign Het
Cct4 C T 11: 23,002,171 L391F probably damaging Het
Cep63 A T 9: 102,588,900 D642E possibly damaging Het
Chd5 T A 4: 152,378,734 L1424Q probably damaging Het
Cox4i1 A G 8: 120,673,350 Y71C probably damaging Het
Cyp2c69 T A 19: 39,876,224 Q270L possibly damaging Het
Egln2 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 7: 27,165,005 probably benign Het
Fbln1 A G 15: 85,229,590 D175G probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm9847 A G 12: 14,494,931 noncoding transcript Het
Hdlbp A T 1: 93,421,101 S576T probably benign Het
Hmgxb3 T C 18: 61,165,504 N296S probably benign Het
Lrba T A 3: 86,664,526 V2379E probably damaging Het
Lrp1b A T 2: 41,728,576 I162N probably benign Het
Mydgf A G 17: 56,179,362 probably null Het
Sh3pxd2a T C 19: 47,268,383 D632G probably benign Het
Ska3 T C 14: 57,820,269 M209V probably damaging Het
Slc4a10 A G 2: 62,250,443 E308G probably damaging Het
Srsf4 C T 4: 131,897,685 T131M probably damaging Het
Suco A T 1: 161,857,456 S156T probably benign Het
Svs2 T A 2: 164,237,248 Q246H possibly damaging Het
Syne2 A G 12: 75,941,189 probably null Het
Tbc1d9b T A 11: 50,152,649 H532Q possibly damaging Het
Tcf21 G A 10: 22,819,590 T105I probably damaging Het
Thsd7a C A 6: 12,418,370 C620F probably damaging Het
Vmn2r94 T C 17: 18,257,082 S356G possibly damaging Het
Wasf1 T A 10: 40,936,526 I437N unknown Het
Wdr24 A G 17: 25,827,467 Y538C probably benign Het
Zbtb4 G T 11: 69,776,219 D117Y probably damaging Het
Zfp654 A T 16: 64,785,336 F293L probably damaging Het
Zkscan7 A G 9: 122,890,723 E158G probably damaging Het
Other mutations in Vmn1r194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Vmn1r194 APN 13 22244606 missense probably benign 0.01
IGL02140:Vmn1r194 APN 13 22244536 missense probably benign 0.08
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0066:Vmn1r194 UTSW 13 22244471 missense probably benign 0.33
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R0109:Vmn1r194 UTSW 13 22245047 missense probably damaging 1.00
R1426:Vmn1r194 UTSW 13 22245066 missense probably damaging 0.99
R1620:Vmn1r194 UTSW 13 22244963 missense probably damaging 1.00
R4593:Vmn1r194 UTSW 13 22244291 missense possibly damaging 0.60
R4844:Vmn1r194 UTSW 13 22245053 missense probably benign 0.02
R5011:Vmn1r194 UTSW 13 22244888 missense probably benign 0.00
R5110:Vmn1r194 UTSW 13 22245000 missense probably benign 0.07
R5588:Vmn1r194 UTSW 13 22244342 missense possibly damaging 0.75
R5810:Vmn1r194 UTSW 13 22244427 nonsense probably null
R6648:Vmn1r194 UTSW 13 22244524 missense probably benign 0.11
R7660:Vmn1r194 UTSW 13 22244597 missense not run
R7663:Vmn1r194 UTSW 13 22244741 missense not run
R7879:Vmn1r194 UTSW 13 22244602 missense probably benign 0.06
R7962:Vmn1r194 UTSW 13 22244602 missense probably benign 0.06
Z1176:Vmn1r194 UTSW 13 22244426 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTATCTAGCAAGGATGGCACGGGG -3'
(R):5'- GCTCACAGAGGAATGGAATCCTAGC -3'

Sequencing Primer
(F):5'- AGTACAGTCCAGGCTGTCAC -3'
(R):5'- CTCTGTTCATCAGAATAAAGGGGC -3'
Posted On2014-01-29