Mutagenetix > Incidental Mutations

Incidental Mutation 'R1276:Ska3'

150906

Institutional Source

Beutler Lab

Gene Symbol

Ska3

Ensembl Gene

ENSMUSG00000021965

Gene Name

spindle and kinetochore associated complex subunit 3

Synonyms

MMRRC Submission

039342-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R1276 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57806561-57826185 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57820269 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 209 (M209V)

Ref Sequence

ENSEMBL: ENSMUSP00000022536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022536]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022536
AA Change: M209V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: M209V

Domain	Start	End	E-Value	Type
PDB:4AJ5\|Z	1	101	3e-46	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225646

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225753

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra2	C	A	8: 27,119,824	A660D	probably damaging	Het
Ccdc82	A	T	9: 13,281,413	I443F	probably benign	Het
Cct4	C	T	11: 23,002,171	L391F	probably damaging	Het
Cep63	A	T	9: 102,588,900	D642E	possibly damaging	Het
Chd5	T	A	4: 152,378,734	L1424Q	probably damaging	Het
Cox4i1	A	G	8: 120,673,350	Y71C	probably damaging	Het
Cyp2c69	T	A	19: 39,876,224	Q270L	possibly damaging	Het
Egln2	TTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTG	7: 27,165,005		probably benign	Het
Fbln1	A	G	15: 85,229,590	D175G	probably damaging	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Gm9847	A	G	12: 14,494,931		noncoding transcript	Het
Hdlbp	A	T	1: 93,421,101	S576T	probably benign	Het
Hmgxb3	T	C	18: 61,165,504	N296S	probably benign	Het
Lrba	T	A	3: 86,664,526	V2379E	probably damaging	Het
Lrp1b	A	T	2: 41,728,576	I162N	probably benign	Het
Mydgf	A	G	17: 56,179,362		probably null	Het
Sh3pxd2a	T	C	19: 47,268,383	D632G	probably benign	Het
Slc4a10	A	G	2: 62,250,443	E308G	probably damaging	Het
Srsf4	C	T	4: 131,897,685	T131M	probably damaging	Het
Suco	A	T	1: 161,857,456	S156T	probably benign	Het
Svs2	T	A	2: 164,237,248	Q246H	possibly damaging	Het
Syne2	A	G	12: 75,941,189		probably null	Het
Tbc1d9b	T	A	11: 50,152,649	H532Q	possibly damaging	Het
Tcf21	G	A	10: 22,819,590	T105I	probably damaging	Het
Thsd7a	C	A	6: 12,418,370	C620F	probably damaging	Het
Vmn1r194	A	G	13: 22,244,861	Y216C	probably damaging	Het
Vmn2r94	T	C	17: 18,257,082	S356G	possibly damaging	Het
Wasf1	T	A	10: 40,936,526	I437N	unknown	Het
Wdr24	A	G	17: 25,827,467	Y538C	probably benign	Het
Zbtb4	G	T	11: 69,776,219	D117Y	probably damaging	Het
Zfp654	A	T	16: 64,785,336	F293L	probably damaging	Het
Zkscan7	A	G	9: 122,890,723	E158G	probably damaging	Het

Other mutations in Ska3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Ska3	APN	14	57822124	missense	possibly damaging	0.95
IGL01969:Ska3	APN	14	57811662	missense	probably benign	0.00
IGL02539:Ska3	APN	14	57820511	missense	possibly damaging	0.86
IGL02665:Ska3	APN	14	57822072	missense	probably damaging	1.00
R3737:Ska3	UTSW	14	57811596	missense	probably benign	0.00
R3738:Ska3	UTSW	14	57811596	missense	probably benign	0.00
R3771:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R3772:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R3773:Ska3	UTSW	14	57810077	missense	probably benign	0.06
R5269:Ska3	UTSW	14	57822116	missense	possibly damaging	0.87
R6088:Ska3	UTSW	14	57816694	missense	probably benign	0.01
R6320:Ska3	UTSW	14	57816691	missense	probably benign	0.04
R7792:Ska3	UTSW	14	57810055	missense	probably damaging	0.97
R8108:Ska3	UTSW	14	57826102	missense	probably damaging	1.00
R8362:Ska3	UTSW	14	57816648	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- aggaggataagagGTCAGGGGTCA -3'
(R):5'- GCGAAGCCCACAGCTCTCAG -3'

Sequencing Primer
(F):5'- gcaggaagcacaaatcagac -3'
(R):5'- ACAGCTCTCAGACTTTGGAC -3'

Posted On

2014-01-29