Incidental Mutation 'R1276:Ska3'
ID150906
Institutional Source Beutler Lab
Gene Symbol Ska3
Ensembl Gene ENSMUSG00000021965
Gene Namespindle and kinetochore associated complex subunit 3
Synonyms
MMRRC Submission 039342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1276 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57806561-57826185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57820269 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 209 (M209V)
Ref Sequence ENSEMBL: ENSMUSP00000022536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022536]
Predicted Effect probably damaging
Transcript: ENSMUST00000022536
AA Change: M209V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: M209V

DomainStartEndE-ValueType
PDB:4AJ5|Z 1 101 3e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225753
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,119,824 A660D probably damaging Het
Ccdc82 A T 9: 13,281,413 I443F probably benign Het
Cct4 C T 11: 23,002,171 L391F probably damaging Het
Cep63 A T 9: 102,588,900 D642E possibly damaging Het
Chd5 T A 4: 152,378,734 L1424Q probably damaging Het
Cox4i1 A G 8: 120,673,350 Y71C probably damaging Het
Cyp2c69 T A 19: 39,876,224 Q270L possibly damaging Het
Egln2 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 7: 27,165,005 probably benign Het
Fbln1 A G 15: 85,229,590 D175G probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm9847 A G 12: 14,494,931 noncoding transcript Het
Hdlbp A T 1: 93,421,101 S576T probably benign Het
Hmgxb3 T C 18: 61,165,504 N296S probably benign Het
Lrba T A 3: 86,664,526 V2379E probably damaging Het
Lrp1b A T 2: 41,728,576 I162N probably benign Het
Mydgf A G 17: 56,179,362 probably null Het
Sh3pxd2a T C 19: 47,268,383 D632G probably benign Het
Slc4a10 A G 2: 62,250,443 E308G probably damaging Het
Srsf4 C T 4: 131,897,685 T131M probably damaging Het
Suco A T 1: 161,857,456 S156T probably benign Het
Svs2 T A 2: 164,237,248 Q246H possibly damaging Het
Syne2 A G 12: 75,941,189 probably null Het
Tbc1d9b T A 11: 50,152,649 H532Q possibly damaging Het
Tcf21 G A 10: 22,819,590 T105I probably damaging Het
Thsd7a C A 6: 12,418,370 C620F probably damaging Het
Vmn1r194 A G 13: 22,244,861 Y216C probably damaging Het
Vmn2r94 T C 17: 18,257,082 S356G possibly damaging Het
Wasf1 T A 10: 40,936,526 I437N unknown Het
Wdr24 A G 17: 25,827,467 Y538C probably benign Het
Zbtb4 G T 11: 69,776,219 D117Y probably damaging Het
Zfp654 A T 16: 64,785,336 F293L probably damaging Het
Zkscan7 A G 9: 122,890,723 E158G probably damaging Het
Other mutations in Ska3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Ska3 APN 14 57822124 missense possibly damaging 0.95
IGL01969:Ska3 APN 14 57811662 missense probably benign 0.00
IGL02539:Ska3 APN 14 57820511 missense possibly damaging 0.86
IGL02665:Ska3 APN 14 57822072 missense probably damaging 1.00
R3737:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3738:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3771:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3772:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3773:Ska3 UTSW 14 57810077 missense probably benign 0.06
R5269:Ska3 UTSW 14 57822116 missense possibly damaging 0.87
R6088:Ska3 UTSW 14 57816694 missense probably benign 0.01
R6320:Ska3 UTSW 14 57816691 missense probably benign 0.04
R7792:Ska3 UTSW 14 57810055 missense probably damaging 0.97
R8108:Ska3 UTSW 14 57826102 missense probably damaging 1.00
R8362:Ska3 UTSW 14 57816648 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- aggaggataagagGTCAGGGGTCA -3'
(R):5'- GCGAAGCCCACAGCTCTCAG -3'

Sequencing Primer
(F):5'- gcaggaagcacaaatcagac -3'
(R):5'- ACAGCTCTCAGACTTTGGAC -3'
Posted On2014-01-29