Incidental Mutation 'R1276:Fbln1'
ID150909
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
MMRRC Submission 039342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R1276 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85229590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000105058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410] [ENSMUST00000109432]
Predicted Effect probably damaging
Transcript: ENSMUST00000057410
AA Change: D175G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369
AA Change: D175G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109432
AA Change: D175G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105058
Gene: ENSMUSG00000006369
AA Change: D175G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF_CA 527 571 7.18e-7 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,119,824 A660D probably damaging Het
Ccdc82 A T 9: 13,281,413 I443F probably benign Het
Cct4 C T 11: 23,002,171 L391F probably damaging Het
Cep63 A T 9: 102,588,900 D642E possibly damaging Het
Chd5 T A 4: 152,378,734 L1424Q probably damaging Het
Cox4i1 A G 8: 120,673,350 Y71C probably damaging Het
Cyp2c69 T A 19: 39,876,224 Q270L possibly damaging Het
Egln2 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 7: 27,165,005 probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm9847 A G 12: 14,494,931 noncoding transcript Het
Hdlbp A T 1: 93,421,101 S576T probably benign Het
Hmgxb3 T C 18: 61,165,504 N296S probably benign Het
Lrba T A 3: 86,664,526 V2379E probably damaging Het
Lrp1b A T 2: 41,728,576 I162N probably benign Het
Mydgf A G 17: 56,179,362 probably null Het
Sh3pxd2a T C 19: 47,268,383 D632G probably benign Het
Ska3 T C 14: 57,820,269 M209V probably damaging Het
Slc4a10 A G 2: 62,250,443 E308G probably damaging Het
Srsf4 C T 4: 131,897,685 T131M probably damaging Het
Suco A T 1: 161,857,456 S156T probably benign Het
Svs2 T A 2: 164,237,248 Q246H possibly damaging Het
Syne2 A G 12: 75,941,189 probably null Het
Tbc1d9b T A 11: 50,152,649 H532Q possibly damaging Het
Tcf21 G A 10: 22,819,590 T105I probably damaging Het
Thsd7a C A 6: 12,418,370 C620F probably damaging Het
Vmn1r194 A G 13: 22,244,861 Y216C probably damaging Het
Vmn2r94 T C 17: 18,257,082 S356G possibly damaging Het
Wasf1 T A 10: 40,936,526 I437N unknown Het
Wdr24 A G 17: 25,827,467 Y538C probably benign Het
Zbtb4 G T 11: 69,776,219 D117Y probably damaging Het
Zfp654 A T 16: 64,785,336 F293L probably damaging Het
Zkscan7 A G 9: 122,890,723 E158G probably damaging Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2312:Fbln1 UTSW 15 85263348 missense probably benign 0.28
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3083:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R3753:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4407:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7231:Fbln1 UTSW 15 85206152 missense unknown
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
R7492:Fbln1 UTSW 15 85227061 missense probably damaging 1.00
R7742:Fbln1 UTSW 15 85240716 missense probably damaging 1.00
R8100:Fbln1 UTSW 15 85285156 missense probably damaging 1.00
R8379:Fbln1 UTSW 15 85232572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAGCTTTAGACTCACCGACTACG -3'
(R):5'- GCCTTGGAGAAGTATCATCACCCAC -3'

Sequencing Primer
(F):5'- CGACTACGATAACTAATTCAGGCTG -3'
(R):5'- AGTGCTCACACCAGTCCTG -3'
Posted On2014-01-29