Incidental Mutation 'R1276:Zfp654'
ID150911
Institutional Source Beutler Lab
Gene Symbol Zfp654
Ensembl Gene ENSMUSG00000047141
Gene Namezinc finger protein 654
Synonyms1810008K20Rik, 1600021C16Rik
MMRRC Submission 039342-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R1276 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location64780347-64851652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64785336 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 293 (F293L)
Ref Sequence ENSEMBL: ENSMUSP00000052946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052588] [ENSMUST00000207826]
Predicted Effect probably damaging
Transcript: ENSMUST00000052588
AA Change: F293L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052946
Gene: ENSMUSG00000047141
AA Change: F293L

DomainStartEndE-ValueType
ZnF_C2H2 25 47 1.69e-3 SMART
low complexity region 117 132 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
ZnF_C2H2 197 222 1.25e-1 SMART
ZnF_C2H2 238 260 4.65e-1 SMART
ZnF_C2H2 266 290 4.98e-1 SMART
ZnF_C2H2 295 319 7.49e0 SMART
ZnF_C2H2 534 554 1.49e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207826
AA Change: F834L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 C A 8: 27,119,824 A660D probably damaging Het
Ccdc82 A T 9: 13,281,413 I443F probably benign Het
Cct4 C T 11: 23,002,171 L391F probably damaging Het
Cep63 A T 9: 102,588,900 D642E possibly damaging Het
Chd5 T A 4: 152,378,734 L1424Q probably damaging Het
Cox4i1 A G 8: 120,673,350 Y71C probably damaging Het
Cyp2c69 T A 19: 39,876,224 Q270L possibly damaging Het
Egln2 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 7: 27,165,005 probably benign Het
Fbln1 A G 15: 85,229,590 D175G probably damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Gm9847 A G 12: 14,494,931 noncoding transcript Het
Hdlbp A T 1: 93,421,101 S576T probably benign Het
Hmgxb3 T C 18: 61,165,504 N296S probably benign Het
Lrba T A 3: 86,664,526 V2379E probably damaging Het
Lrp1b A T 2: 41,728,576 I162N probably benign Het
Mydgf A G 17: 56,179,362 probably null Het
Sh3pxd2a T C 19: 47,268,383 D632G probably benign Het
Ska3 T C 14: 57,820,269 M209V probably damaging Het
Slc4a10 A G 2: 62,250,443 E308G probably damaging Het
Srsf4 C T 4: 131,897,685 T131M probably damaging Het
Suco A T 1: 161,857,456 S156T probably benign Het
Svs2 T A 2: 164,237,248 Q246H possibly damaging Het
Syne2 A G 12: 75,941,189 probably null Het
Tbc1d9b T A 11: 50,152,649 H532Q possibly damaging Het
Tcf21 G A 10: 22,819,590 T105I probably damaging Het
Thsd7a C A 6: 12,418,370 C620F probably damaging Het
Vmn1r194 A G 13: 22,244,861 Y216C probably damaging Het
Vmn2r94 T C 17: 18,257,082 S356G possibly damaging Het
Wasf1 T A 10: 40,936,526 I437N unknown Het
Wdr24 A G 17: 25,827,467 Y538C probably benign Het
Zbtb4 G T 11: 69,776,219 D117Y probably damaging Het
Zkscan7 A G 9: 122,890,723 E158G probably damaging Het
Other mutations in Zfp654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp654 APN 16 64784641 missense probably benign 0.02
IGL02043:Zfp654 APN 16 64785028 missense probably benign 0.00
IGL02205:Zfp654 APN 16 64785966 missense probably damaging 1.00
IGL02337:Zfp654 APN 16 64785149 missense probably benign 0.00
IGL02398:Zfp654 APN 16 64786018 missense probably benign 0.00
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0025:Zfp654 UTSW 16 64784818 missense probably benign 0.31
R0193:Zfp654 UTSW 16 64785688 missense possibly damaging 0.76
R1851:Zfp654 UTSW 16 64785128 missense probably benign 0.34
R4065:Zfp654 UTSW 16 64785925 missense possibly damaging 0.87
R4872:Zfp654 UTSW 16 64785782 missense probably benign 0.28
R5693:Zfp654 UTSW 16 64785926 missense probably benign 0.00
R6362:Zfp654 UTSW 16 64786094 nonsense probably null
R6483:Zfp654 UTSW 16 64791947 missense possibly damaging 0.93
R6666:Zfp654 UTSW 16 64786233 missense probably benign 0.25
R6852:Zfp654 UTSW 16 64786598 missense probably damaging 1.00
R6917:Zfp654 UTSW 16 64786471 missense probably damaging 0.98
R7289:Zfp654 UTSW 16 64785160 missense probably benign
R7506:Zfp654 UTSW 16 64791848 missense probably damaging 0.98
R7598:Zfp654 UTSW 16 64785934 missense possibly damaging 0.49
R7721:Zfp654 UTSW 16 64786207 missense probably damaging 1.00
R7791:Zfp654 UTSW 16 64783271 makesense probably null
R7884:Zfp654 UTSW 16 64851648 missense probably damaging 0.99
R7966:Zfp654 UTSW 16 64784876 missense probably damaging 1.00
R8361:Zfp654 UTSW 16 64791857 missense probably damaging 1.00
Z1176:Zfp654 UTSW 16 64786208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTGGCTCTATGGCAGGCATC -3'
(R):5'- TGCAAGGACTGTGCATCCAACTG -3'

Sequencing Primer
(F):5'- AGGCATCTTTTGGTCTATCAAGC -3'
(R):5'- TGTGCGGCAAACTGTAATG -3'
Posted On2014-01-29