Incidental Mutation 'R1277:Ralgps1'
ID150919
Institutional Source Beutler Lab
Gene Symbol Ralgps1
Ensembl Gene ENSMUSG00000038831
Gene NameRal GEF with PH domain and SH3 binding motif 1
SynonymsRALGPS1A, 5830418G11Rik, RALGEF2
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location33133417-33371486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33174425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000048451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298]
PDB Structure
Crystal structure of MS0666 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042615
AA Change: V228A

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831
AA Change: V228A

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
AA Change: V245A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831
AA Change: V245A

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
AA Change: V245A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831
AA Change: V245A

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
AA Change: V245A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831
AA Change: V245A

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139288
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Ralgps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ralgps1 APN 2 33137682 makesense probably null
IGL00780:Ralgps1 APN 2 33273627 missense probably damaging 1.00
IGL00951:Ralgps1 APN 2 33273602 missense probably damaging 1.00
IGL01358:Ralgps1 APN 2 33143049 missense possibly damaging 0.62
IGL02346:Ralgps1 APN 2 33157770 critical splice donor site probably null
IGL02481:Ralgps1 APN 2 33340729 missense probably benign 0.04
IGL03281:Ralgps1 APN 2 33172416 critical splice donor site probably null
IGL03284:Ralgps1 APN 2 33146565 splice site probably benign
IGL03377:Ralgps1 APN 2 33172461 missense probably damaging 1.00
R0007:Ralgps1 UTSW 2 33143389 missense probably damaging 0.97
R0029:Ralgps1 UTSW 2 33141019 missense probably benign
R0309:Ralgps1 UTSW 2 33157923 missense probably benign
R0320:Ralgps1 UTSW 2 33141015 missense possibly damaging 0.59
R0622:Ralgps1 UTSW 2 33174447 nonsense probably null
R1797:Ralgps1 UTSW 2 33340711 critical splice donor site probably null
R2921:Ralgps1 UTSW 2 33143070 missense probably damaging 0.99
R3123:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R3124:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R4741:Ralgps1 UTSW 2 33336587 missense probably benign 0.00
R4894:Ralgps1 UTSW 2 33143103 missense possibly damaging 0.71
R5148:Ralgps1 UTSW 2 33158987 missense probably damaging 1.00
R5255:Ralgps1 UTSW 2 33276159 missense probably damaging 1.00
R5877:Ralgps1 UTSW 2 33243628 unclassified probably benign
R6330:Ralgps1 UTSW 2 33174443 missense probably damaging 1.00
R6908:Ralgps1 UTSW 2 33143100 missense probably benign 0.17
R7252:Ralgps1 UTSW 2 33168188 missense probably benign 0.12
R7299:Ralgps1 UTSW 2 33157873 missense probably benign
R7366:Ralgps1 UTSW 2 33324688 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGACGTGCCACTCACTAGACAATC -3'
(R):5'- TTTATGCCTTCGTGCCCAGGAGAC -3'

Sequencing Primer
(F):5'- CAAGTTGTTCCGCATGTACCTAAG -3'
(R):5'- TGCCCAGGAGACTGTTTAAC -3'
Posted On2014-01-29