Incidental Mutation 'R1277:Crlf2'
ID150924
Institutional Source Beutler Lab
Gene Symbol Crlf2
Ensembl Gene ENSMUSG00000033467
Gene Namecytokine receptor-like factor 2
SynonymsLy114, Tpte2, Tslpr
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109554709-109558993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109557600 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 30 (V30I)
Ref Sequence ENSEMBL: ENSMUSP00000143641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044579] [ENSMUST00000198960] [ENSMUST00000200284]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044579
AA Change: V32I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036326
Gene: ENSMUSG00000033467
AA Change: V32I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 84 102 N/A INTRINSIC
FN3 117 196 2.58e-4 SMART
low complexity region 210 253 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196881
Predicted Effect probably benign
Transcript: ENSMUST00000198960
SMART Domains Protein: ENSMUSP00000142982
Gene: ENSMUSG00000033467

DomainStartEndE-ValueType
Blast:FN3 1 52 2e-30 BLAST
SCOP:d1eerb2 1 65 7e-8 SMART
PDB:4NN7|C 1 66 2e-41 PDB
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200284
AA Change: V30I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143641
Gene: ENSMUSG00000033467
AA Change: V30I

DomainStartEndE-ValueType
low complexity region 82 100 N/A INTRINSIC
FN3 115 194 1.3e-6 SMART
low complexity region 208 251 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are overtly normal and maintain normal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Rfx7 A G 9: 72,593,312 E118G probably benign Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Crlf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Crlf2 APN 5 109557570 missense possibly damaging 0.66
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0732:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0898:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R1674:Crlf2 UTSW 5 109558803 critical splice donor site probably null
R1912:Crlf2 UTSW 5 109557141 missense possibly damaging 0.83
R5276:Crlf2 UTSW 5 109557635 unclassified probably benign
R5418:Crlf2 UTSW 5 109557033 missense probably benign 0.05
R5984:Crlf2 UTSW 5 109555603 missense probably damaging 1.00
R6848:Crlf2 UTSW 5 109557031 missense possibly damaging 0.66
R7437:Crlf2 UTSW 5 109554973 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCCCACGAGCATCTGAATTTCAAC -3'
(R):5'- CGAGCCAGAATGTCTTCCTCTGTC -3'

Sequencing Primer
(F):5'- GGAAGTACCGTCCCTAATCATTTG -3'
(R):5'- TGTCTTCCCCTGCCTAGTG -3'
Posted On2014-01-29