Incidental Mutation 'R1277:Rfx7'
ID150927
Institutional Source Beutler Lab
Gene Symbol Rfx7
Ensembl Gene ENSMUSG00000037674
Gene Nameregulatory factor X, 7
Synonyms9930116O05Rik, D130086K05Rik, 2510005N23Rik, Rfxdc2
MMRRC Submission 039343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R1277 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72532240-72622937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72593312 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 118 (E118G)
Ref Sequence ENSEMBL: ENSMUSP00000127192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093820] [ENSMUST00000163401] [ENSMUST00000183372] [ENSMUST00000184015]
Predicted Effect probably benign
Transcript: ENSMUST00000093820
AA Change: E118G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091338
Gene: ENSMUSG00000037674
AA Change: E118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 101 185 3.1e-39 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163401
AA Change: E118G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127192
Gene: ENSMUSG00000037674
AA Change: E118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 105 183 2.9e-33 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183372
AA Change: E118G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139195
Gene: ENSMUSG00000037674
AA Change: E118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184015
AA Change: E118G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138957
Gene: ENSMUSG00000037674
AA Change: E118G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-12 PDB
Pfam:RFX_DNA_binding 101 185 9e-40 PFAM
Pfam:Pox_D5 109 196 1.8e-8 PFAM
low complexity region 259 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192251
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RFX7 is a member of the regulatory factor X (RFX) family of transcription factors (see RFX1, MIM 600006) (Aftab et al., 2008 [PubMed 18673564]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Appl1 A C 14: 26,927,856 V571G possibly damaging Het
Chd6 A T 2: 160,967,815 C1509S probably damaging Het
Clk4 A G 11: 51,267,189 T7A probably benign Het
Crlf2 C T 5: 109,557,600 V30I possibly damaging Het
Itpr1 A G 6: 108,339,621 H93R probably benign Het
Lrp1b A G 2: 40,725,945 V3593A probably benign Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Pcdhb11 A T 18: 37,421,716 Y33F possibly damaging Het
Pkd2 A G 5: 104,502,359 I862V probably damaging Het
Prl3c1 T C 13: 27,203,572 L180P probably damaging Het
Ralgps1 A G 2: 33,174,425 V228A possibly damaging Het
Slc17a8 T C 10: 89,597,457 T51A possibly damaging Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Zfp414 G T 17: 33,630,475 probably null Het
Other mutations in Rfx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rfx7 APN 9 72607690 missense probably damaging 1.00
IGL00323:Rfx7 APN 9 72617420 missense probably damaging 0.97
IGL00920:Rfx7 APN 9 72593356 missense probably damaging 1.00
IGL01317:Rfx7 APN 9 72618536 missense probably damaging 0.98
IGL01405:Rfx7 APN 9 72610344 missense probably benign 0.02
IGL01585:Rfx7 APN 9 72617061 missense probably benign 0.41
IGL02118:Rfx7 APN 9 72617204 missense probably benign
IGL02205:Rfx7 APN 9 72607650 missense probably damaging 1.00
IGL02608:Rfx7 APN 9 72617294 missense probably benign 0.00
IGL02629:Rfx7 APN 9 72619259 missense probably damaging 0.96
IGL02963:Rfx7 APN 9 72617616 missense probably benign 0.00
IGL03026:Rfx7 APN 9 72619685 missense probably damaging 1.00
IGL03033:Rfx7 APN 9 72532989 splice site probably benign
IGL03212:Rfx7 APN 9 72619161 missense probably benign 0.06
IGL03221:Rfx7 APN 9 72618806 missense probably damaging 0.99
PIT4431001:Rfx7 UTSW 9 72617971 missense probably benign
R0365:Rfx7 UTSW 9 72619836 missense probably benign 0.15
R0449:Rfx7 UTSW 9 72610304 critical splice acceptor site probably null
R0464:Rfx7 UTSW 9 72618204 missense probably damaging 1.00
R0746:Rfx7 UTSW 9 72619106 missense probably benign 0.00
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1263:Rfx7 UTSW 9 72577047 missense possibly damaging 0.79
R1330:Rfx7 UTSW 9 72617265 missense probably benign 0.00
R1371:Rfx7 UTSW 9 72619575 missense probably damaging 1.00
R1605:Rfx7 UTSW 9 72611789 missense probably damaging 1.00
R1802:Rfx7 UTSW 9 72619637 missense possibly damaging 0.50
R1903:Rfx7 UTSW 9 72616811 missense probably damaging 1.00
R2018:Rfx7 UTSW 9 72617685 missense probably benign 0.01
R2050:Rfx7 UTSW 9 72617466 missense probably benign 0.01
R2190:Rfx7 UTSW 9 72617919 missense probably benign 0.00
R2208:Rfx7 UTSW 9 72617964 missense probably benign 0.00
R2921:Rfx7 UTSW 9 72617664 missense possibly damaging 0.63
R3978:Rfx7 UTSW 9 72615111 missense possibly damaging 0.80
R4231:Rfx7 UTSW 9 72619390 missense possibly damaging 0.77
R4243:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4244:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4245:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4261:Rfx7 UTSW 9 72616643 missense probably damaging 1.00
R4844:Rfx7 UTSW 9 72593242 nonsense probably null
R4902:Rfx7 UTSW 9 72617291 missense probably benign 0.05
R5432:Rfx7 UTSW 9 72593302 missense probably benign 0.35
R5627:Rfx7 UTSW 9 72532784 start gained probably benign
R5900:Rfx7 UTSW 9 72617256 missense probably benign
R5991:Rfx7 UTSW 9 72619538 missense possibly damaging 0.54
R6273:Rfx7 UTSW 9 72616997 missense possibly damaging 0.47
R6306:Rfx7 UTSW 9 72616955 missense possibly damaging 0.63
R6324:Rfx7 UTSW 9 72618414 missense probably damaging 1.00
R6437:Rfx7 UTSW 9 72618486 missense possibly damaging 0.66
R6860:Rfx7 UTSW 9 72616944 missense probably damaging 1.00
R6998:Rfx7 UTSW 9 72618505 missense probably damaging 1.00
R7255:Rfx7 UTSW 9 72619828 missense possibly damaging 0.77
R7336:Rfx7 UTSW 9 72593357 missense probably damaging 1.00
R7501:Rfx7 UTSW 9 72616772 missense probably benign
R7857:Rfx7 UTSW 9 72593323 missense possibly damaging 0.89
R7940:Rfx7 UTSW 9 72593323 missense possibly damaging 0.89
Z1177:Rfx7 UTSW 9 72615244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATCCAAGCCAGCAGTTTAGCC -3'
(R):5'- TGTCCTCAGAAGCCTGGACAAAGC -3'

Sequencing Primer
(F):5'- CAGGCCAGTATTTTCAGTCTGAAAC -3'
(R):5'- GGACAAAGCCCTCATTTAATACTCTG -3'
Posted On2014-01-29